ID: 1119379478

View in Genome Browser
Species Human (GRCh38)
Location 14:74219479-74219501
Sequence GGAGGATTGGGGGCTGCCAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119379478_1119379493 7 Left 1119379478 14:74219479-74219501 CCCATGGCAGCCCCCAATCCTCC No data
Right 1119379493 14:74219509-74219531 CCCAGGCGCGGGTTTCCAGGAGG No data
1119379478_1119379490 4 Left 1119379478 14:74219479-74219501 CCCATGGCAGCCCCCAATCCTCC No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data
1119379478_1119379495 14 Left 1119379478 14:74219479-74219501 CCCATGGCAGCCCCCAATCCTCC No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data
1119379478_1119379484 -10 Left 1119379478 14:74219479-74219501 CCCATGGCAGCCCCCAATCCTCC No data
Right 1119379484 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
1119379478_1119379487 -4 Left 1119379478 14:74219479-74219501 CCCATGGCAGCCCCCAATCCTCC No data
Right 1119379487 14:74219498-74219520 CTCCCAGCATCCCCAGGCGCGGG No data
1119379478_1119379486 -5 Left 1119379478 14:74219479-74219501 CCCATGGCAGCCCCCAATCCTCC No data
Right 1119379486 14:74219497-74219519 CCTCCCAGCATCCCCAGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119379478 Original CRISPR GGAGGATTGGGGGCTGCCAT GGG (reversed) Intergenic