ID: 1119379479

View in Genome Browser
Species Human (GRCh38)
Location 14:74219480-74219502
Sequence GGGAGGATTGGGGGCTGCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119379479_1119379493 6 Left 1119379479 14:74219480-74219502 CCATGGCAGCCCCCAATCCTCCC No data
Right 1119379493 14:74219509-74219531 CCCAGGCGCGGGTTTCCAGGAGG No data
1119379479_1119379490 3 Left 1119379479 14:74219480-74219502 CCATGGCAGCCCCCAATCCTCCC No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data
1119379479_1119379487 -5 Left 1119379479 14:74219480-74219502 CCATGGCAGCCCCCAATCCTCCC No data
Right 1119379487 14:74219498-74219520 CTCCCAGCATCCCCAGGCGCGGG No data
1119379479_1119379486 -6 Left 1119379479 14:74219480-74219502 CCATGGCAGCCCCCAATCCTCCC No data
Right 1119379486 14:74219497-74219519 CCTCCCAGCATCCCCAGGCGCGG No data
1119379479_1119379495 13 Left 1119379479 14:74219480-74219502 CCATGGCAGCCCCCAATCCTCCC No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119379479 Original CRISPR GGGAGGATTGGGGGCTGCCA TGG (reversed) Intergenic