ID: 1119379483

View in Genome Browser
Species Human (GRCh38)
Location 14:74219492-74219514
Sequence CCTGGGGATGCTGGGAGGAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119379483_1119379495 1 Left 1119379483 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data
1119379483_1119379493 -6 Left 1119379483 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
Right 1119379493 14:74219509-74219531 CCCAGGCGCGGGTTTCCAGGAGG No data
1119379483_1119379499 24 Left 1119379483 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
Right 1119379499 14:74219539-74219561 CCACTGCCCCCTCCCCAGCCTGG No data
1119379483_1119379490 -9 Left 1119379483 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119379483 Original CRISPR CCTGGGGATGCTGGGAGGAT TGG (reversed) Intergenic