ID: 1119379484

View in Genome Browser
Species Human (GRCh38)
Location 14:74219492-74219514
Sequence CCAATCCTCCCAGCATCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119379476_1119379484 -1 Left 1119379476 14:74219470-74219492 CCCTGAGGTCCCATGGCAGCCCC No data
Right 1119379484 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
1119379477_1119379484 -2 Left 1119379477 14:74219471-74219493 CCTGAGGTCCCATGGCAGCCCCC No data
Right 1119379484 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
1119379474_1119379484 10 Left 1119379474 14:74219459-74219481 CCGGTCAGGAGCCCTGAGGTCCC No data
Right 1119379484 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
1119379469_1119379484 25 Left 1119379469 14:74219444-74219466 CCACACCAGGAACCACCGGTCAG No data
Right 1119379484 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
1119379473_1119379484 13 Left 1119379473 14:74219456-74219478 CCACCGGTCAGGAGCCCTGAGGT No data
Right 1119379484 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
1119379471_1119379484 20 Left 1119379471 14:74219449-74219471 CCAGGAACCACCGGTCAGGAGCC No data
Right 1119379484 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
1119379478_1119379484 -10 Left 1119379478 14:74219479-74219501 CCCATGGCAGCCCCCAATCCTCC No data
Right 1119379484 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119379484 Original CRISPR CCAATCCTCCCAGCATCCCC AGG Intergenic