ID: 1119379487

View in Genome Browser
Species Human (GRCh38)
Location 14:74219498-74219520
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119379478_1119379487 -4 Left 1119379478 14:74219479-74219501 CCCATGGCAGCCCCCAATCCTCC No data
Right 1119379487 14:74219498-74219520 CTCCCAGCATCCCCAGGCGCGGG No data
1119379473_1119379487 19 Left 1119379473 14:74219456-74219478 CCACCGGTCAGGAGCCCTGAGGT No data
Right 1119379487 14:74219498-74219520 CTCCCAGCATCCCCAGGCGCGGG No data
1119379479_1119379487 -5 Left 1119379479 14:74219480-74219502 CCATGGCAGCCCCCAATCCTCCC No data
Right 1119379487 14:74219498-74219520 CTCCCAGCATCCCCAGGCGCGGG No data
1119379474_1119379487 16 Left 1119379474 14:74219459-74219481 CCGGTCAGGAGCCCTGAGGTCCC No data
Right 1119379487 14:74219498-74219520 CTCCCAGCATCCCCAGGCGCGGG No data
1119379471_1119379487 26 Left 1119379471 14:74219449-74219471 CCAGGAACCACCGGTCAGGAGCC No data
Right 1119379487 14:74219498-74219520 CTCCCAGCATCCCCAGGCGCGGG No data
1119379477_1119379487 4 Left 1119379477 14:74219471-74219493 CCTGAGGTCCCATGGCAGCCCCC No data
Right 1119379487 14:74219498-74219520 CTCCCAGCATCCCCAGGCGCGGG No data
1119379476_1119379487 5 Left 1119379476 14:74219470-74219492 CCCTGAGGTCCCATGGCAGCCCC No data
Right 1119379487 14:74219498-74219520 CTCCCAGCATCCCCAGGCGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119379487 Original CRISPR CTCCCAGCATCCCCAGGCGC GGG Intergenic