ID: 1119379490

View in Genome Browser
Species Human (GRCh38)
Location 14:74219506-74219528
Sequence ATCCCCAGGCGCGGGTTTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119379482_1119379490 -8 Left 1119379482 14:74219491-74219513 CCCAATCCTCCCAGCATCCCCAG No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data
1119379474_1119379490 24 Left 1119379474 14:74219459-74219481 CCGGTCAGGAGCCCTGAGGTCCC No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data
1119379478_1119379490 4 Left 1119379478 14:74219479-74219501 CCCATGGCAGCCCCCAATCCTCC No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data
1119379476_1119379490 13 Left 1119379476 14:74219470-74219492 CCCTGAGGTCCCATGGCAGCCCC No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data
1119379477_1119379490 12 Left 1119379477 14:74219471-74219493 CCTGAGGTCCCATGGCAGCCCCC No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data
1119379479_1119379490 3 Left 1119379479 14:74219480-74219502 CCATGGCAGCCCCCAATCCTCCC No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data
1119379483_1119379490 -9 Left 1119379483 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data
1119379473_1119379490 27 Left 1119379473 14:74219456-74219478 CCACCGGTCAGGAGCCCTGAGGT No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data
1119379480_1119379490 -6 Left 1119379480 14:74219489-74219511 CCCCCAATCCTCCCAGCATCCCC No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data
1119379481_1119379490 -7 Left 1119379481 14:74219490-74219512 CCCCAATCCTCCCAGCATCCCCA No data
Right 1119379490 14:74219506-74219528 ATCCCCAGGCGCGGGTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119379490 Original CRISPR ATCCCCAGGCGCGGGTTTCC AGG Intergenic