ID: 1119379495

View in Genome Browser
Species Human (GRCh38)
Location 14:74219516-74219538
Sequence GCGGGTTTCCAGGAGGAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119379477_1119379495 22 Left 1119379477 14:74219471-74219493 CCTGAGGTCCCATGGCAGCCCCC No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data
1119379478_1119379495 14 Left 1119379478 14:74219479-74219501 CCCATGGCAGCCCCCAATCCTCC No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data
1119379476_1119379495 23 Left 1119379476 14:74219470-74219492 CCCTGAGGTCCCATGGCAGCCCC No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data
1119379482_1119379495 2 Left 1119379482 14:74219491-74219513 CCCAATCCTCCCAGCATCCCCAG No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data
1119379489_1119379495 -8 Left 1119379489 14:74219501-74219523 CCAGCATCCCCAGGCGCGGGTTT No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data
1119379480_1119379495 4 Left 1119379480 14:74219489-74219511 CCCCCAATCCTCCCAGCATCCCC No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data
1119379485_1119379495 -4 Left 1119379485 14:74219497-74219519 CCTCCCAGCATCCCCAGGCGCGG No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data
1119379479_1119379495 13 Left 1119379479 14:74219480-74219502 CCATGGCAGCCCCCAATCCTCCC No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data
1119379483_1119379495 1 Left 1119379483 14:74219492-74219514 CCAATCCTCCCAGCATCCCCAGG No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data
1119379488_1119379495 -7 Left 1119379488 14:74219500-74219522 CCCAGCATCCCCAGGCGCGGGTT No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data
1119379481_1119379495 3 Left 1119379481 14:74219490-74219512 CCCCAATCCTCCCAGCATCCCCA No data
Right 1119379495 14:74219516-74219538 GCGGGTTTCCAGGAGGAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119379495 Original CRISPR GCGGGTTTCCAGGAGGAGCC AGG Intergenic