ID: 1119379512

View in Genome Browser
Species Human (GRCh38)
Location 14:74219561-74219583
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119379496_1119379512 14 Left 1119379496 14:74219524-74219546 CCAGGAGGAGCCAGGCCACTGCC No data
Right 1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG No data
1119379501_1119379512 -8 Left 1119379501 14:74219546-74219568 CCCCTCCCCAGCCTGGACACAGA No data
Right 1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG No data
1119379494_1119379512 28 Left 1119379494 14:74219510-74219532 CCAGGCGCGGGTTTCCAGGAGGA No data
Right 1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG No data
1119379491_1119379512 30 Left 1119379491 14:74219508-74219530 CCCCAGGCGCGGGTTTCCAGGAG No data
Right 1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG No data
1119379500_1119379512 -7 Left 1119379500 14:74219545-74219567 CCCCCTCCCCAGCCTGGACACAG No data
Right 1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG No data
1119379497_1119379512 4 Left 1119379497 14:74219534-74219556 CCAGGCCACTGCCCCCTCCCCAG No data
Right 1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG No data
1119379502_1119379512 -9 Left 1119379502 14:74219547-74219569 CCCTCCCCAGCCTGGACACAGAG No data
Right 1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG No data
1119379492_1119379512 29 Left 1119379492 14:74219509-74219531 CCCAGGCGCGGGTTTCCAGGAGG No data
Right 1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG No data
1119379503_1119379512 -10 Left 1119379503 14:74219548-74219570 CCTCCCCAGCCTGGACACAGAGG No data
Right 1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG No data
1119379498_1119379512 -1 Left 1119379498 14:74219539-74219561 CCACTGCCCCCTCCCCAGCCTGG No data
Right 1119379512 14:74219561-74219583 GACACAGAGGGGGCTCCGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119379512 Original CRISPR GACACAGAGGGGGCTCCGTT TGG Intergenic