ID: 1119380086

View in Genome Browser
Species Human (GRCh38)
Location 14:74223005-74223027
Sequence AACCCTATTCTGCCCCTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119380086_1119380088 -5 Left 1119380086 14:74223005-74223027 CCAGGCAGGGGCAGAATAGGGTT No data
Right 1119380088 14:74223023-74223045 GGGTTTACAGGCAAATGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119380086 Original CRISPR AACCCTATTCTGCCCCTGCC TGG (reversed) Intergenic
No off target data available for this crispr