ID: 1119383234

View in Genome Browser
Species Human (GRCh38)
Location 14:74241420-74241442
Sequence CTGCCCGGGGGCCTTGGCGT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 196}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119383225_1119383234 10 Left 1119383225 14:74241387-74241409 CCAGGGCGCAGACCACGGGTTGT 0: 1
1: 0
2: 0
3: 1
4: 50
Right 1119383234 14:74241420-74241442 CTGCCCGGGGGCCTTGGCGTCGG 0: 1
1: 0
2: 1
3: 15
4: 196
1119383228_1119383234 -2 Left 1119383228 14:74241399-74241421 CCACGGGTTGTTTGGCGGAATCT 0: 1
1: 0
2: 0
3: 1
4: 28
Right 1119383234 14:74241420-74241442 CTGCCCGGGGGCCTTGGCGTCGG 0: 1
1: 0
2: 1
3: 15
4: 196
1119383221_1119383234 21 Left 1119383221 14:74241376-74241398 CCGAGGCCGTGCCAGGGCGCAGA 0: 1
1: 0
2: 0
3: 4
4: 180
Right 1119383234 14:74241420-74241442 CTGCCCGGGGGCCTTGGCGTCGG 0: 1
1: 0
2: 1
3: 15
4: 196
1119383222_1119383234 15 Left 1119383222 14:74241382-74241404 CCGTGCCAGGGCGCAGACCACGG 0: 1
1: 0
2: 0
3: 7
4: 116
Right 1119383234 14:74241420-74241442 CTGCCCGGGGGCCTTGGCGTCGG 0: 1
1: 0
2: 1
3: 15
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119383234 Original CRISPR CTGCCCGGGGGCCTTGGCGT CGG Intronic
900579685 1:3402919-3402941 AAGCCCGAGGGCCTTGGCGGTGG + Exonic
900610585 1:3542968-3542990 CTGCCCAGGGGCCTGGGAGGAGG + Intronic
900880815 1:5380094-5380116 CTGCACGGGGGTCTAGGCGAGGG - Intergenic
901629023 1:10639245-10639267 CGGCCCGGGGGCGGCGGCGTCGG + Exonic
902375285 1:16027466-16027488 CTGCCTGGGGGCCGGGGCGAGGG + Intronic
902380247 1:16049276-16049298 CTGCCTGGGGGCCGGGGCGAGGG + Intronic
902509941 1:16961043-16961065 CTGCGCCGGGGCCTCGGCCTCGG + Exonic
903344805 1:22677276-22677298 CTGGCCGGGGGCCTGGGAGGGGG + Intergenic
903413711 1:23167876-23167898 CTGCCCGGGCGGCTGGGCGGGGG + Intronic
904256944 1:29260116-29260138 CTGCCCGGGGGCGTGGCCGTGGG + Intronic
905028325 1:34865891-34865913 CAGCCCGGGCGCCTTCGCGTGGG + Exonic
905318439 1:37098328-37098350 CTGCCCTGGGGCCAAGGCTTTGG + Intergenic
905846955 1:41241755-41241777 CTGCCCGGGGGCCCCGGCACGGG - Intronic
906567215 1:46809689-46809711 CTGCCCAGGGGCCTTGGAAAAGG - Intronic
907635007 1:56125395-56125417 CTCCCTGGGGTCCTTGGCCTGGG - Intergenic
908206226 1:61852615-61852637 ATGCCTGGGGGCCTGGGGGTTGG + Intronic
912670515 1:111620078-111620100 CGGCCCGGGGGCCTGGCCGGCGG + Intronic
913969947 1:143407086-143407108 CTGCCCCAGGGCCTTTGCATGGG + Intergenic
914064321 1:144232680-144232702 CTGCCCCAGGGCCTTTGCATGGG + Intergenic
914114829 1:144733674-144733696 CTGCCCCAGGGCCTTTGCATGGG - Intergenic
916060985 1:161098523-161098545 CTCCCCGGGGCCCATGGCGGTGG + Exonic
917359423 1:174159723-174159745 CTGCCTGGGTGTGTTGGCGTCGG + Intronic
920179209 1:204122265-204122287 CAGCTCGGGGGCCTTGGGCTTGG - Exonic
920263792 1:204707183-204707205 CTGTCCTGGGGCTTTGGCTTAGG + Intergenic
922618571 1:226977451-226977473 CTGGCCGTGGGCCTGGGCTTCGG + Exonic
923034872 1:230278843-230278865 CTGCCTGGAGGCCTTGGTCTGGG - Intronic
1062961876 10:1578534-1578556 CTTCCTGGGGCCCTTGGCGTGGG + Intronic
1067469834 10:46528295-46528317 CTGCCAGGGGGCCTGGTCCTGGG - Intergenic
1070775569 10:79107897-79107919 CTGCCTGAGGGCCCTGGCATGGG + Intronic
1070820219 10:79349965-79349987 CTGCCCGGGGGACTGGGAGGTGG + Intronic
1075884206 10:125883463-125883485 CTTCCCGGTGGCTTGGGCGTGGG - Intronic
1076684864 10:132194019-132194041 CTGGCCGGGTGCCTTGGCACTGG - Intronic
1077228078 11:1447042-1447064 CTCCCAGGGGGCCATGGCCTGGG - Intronic
1078877520 11:15413150-15413172 CTACCCTGGGGCCTGGGAGTGGG - Intergenic
1081599607 11:44484108-44484130 TTGCCCTGGGGCCTTGGCAGAGG - Intergenic
1081863516 11:46347492-46347514 CTTCCCGGGCACCTGGGCGTGGG + Intronic
1081910071 11:46694900-46694922 CTGCTCTGAGGCATTGGCGTGGG - Intronic
1083200603 11:61118935-61118957 GTGGGCGGGGGCCTTGTCGTTGG - Exonic
1083766282 11:64843078-64843100 CTGCCTGTGGGCCTGGGCTTCGG - Intronic
1084118213 11:67054112-67054134 AGGCCAGGGGGCCTTGGAGTAGG + Intergenic
1084175063 11:67418688-67418710 CTACCCGGGGGCCCGGGCATAGG + Intronic
1084274174 11:68043299-68043321 CTGCCCGGGGGGCCTGGTGGGGG + Intronic
1085532547 11:77200613-77200635 ATGCCCCGTGGCCTTGGCCTTGG + Intronic
1086001098 11:81986934-81986956 CTGCCCGGGGCCAGTGGCGCCGG + Intergenic
1089010221 11:115126261-115126283 CTACCCAGGGGGCTTGGAGTGGG - Intergenic
1089383124 11:118050359-118050381 CTGGGCAGGGGCCTTGGCCTAGG - Intergenic
1090265459 11:125350667-125350689 CTGCCTGGAGGCCTTGGGGAAGG - Intronic
1091549991 12:1530121-1530143 CGGCCCGGGGGCCTCGCCGCGGG - Intronic
1096243236 12:49970528-49970550 CTGCCCTGTGGCCTTGAAGTAGG - Intronic
1096497286 12:52045873-52045895 CTGCCCTGGGGGCTTCCCGTGGG - Intronic
1097053086 12:56235263-56235285 CTTCCTGGGGGCCCTGGCGGTGG + Exonic
1104846628 12:131850320-131850342 CTGCCCCAGGGCCTTGGCACTGG + Intronic
1110190841 13:72727462-72727484 CCGCCTGGGGGCCTTGGCTCTGG + Intronic
1119383234 14:74241420-74241442 CTGCCCGGGGGCCTTGGCGTCGG + Intronic
1119615012 14:76093143-76093165 CTGCCCTGGGGTCTTGGCTGAGG - Intergenic
1119667672 14:76496822-76496844 CTCCCAGGGGGCCATGGTGTGGG - Intronic
1120948945 14:90023189-90023211 CTGCCCGGGGGGCTTGGGAAAGG + Intronic
1121916162 14:97838531-97838553 CCTCCCGGGGGCCTGGGGGTGGG - Intergenic
1122156276 14:99752354-99752376 CCGCCCGGCGACCCTGGCGTTGG - Intronic
1122265270 14:100543803-100543825 CTGCCGGTGGGCCTAGGCGAGGG - Intronic
1122399282 14:101457829-101457851 CTGCGCGGGCACCTTGGCGGCGG + Intergenic
1124616508 15:31246043-31246065 CTGCCCGATGGCCATGGTGTTGG + Intergenic
1124645438 15:31434840-31434862 CTGCCCCATGGCCTTGGGGTTGG - Intronic
1124685371 15:31777650-31777672 CTGCCTGGGGGCCTGGGCTGAGG - Intronic
1124818871 15:33022883-33022905 CTGCCTGGGGGTCTTGGCTGGGG + Intronic
1125356218 15:38819623-38819645 CCACCCGGGCGCCTTGGCATGGG - Intergenic
1128292008 15:66485158-66485180 CTCCCGGGGGTCCTTGGCCTGGG - Exonic
1129234928 15:74218278-74218300 CTGCCCGGTGGGCTTGGATTGGG + Intergenic
1129263646 15:74382615-74382637 CTGCCCTGGGACCTTGGGATGGG - Intergenic
1130147021 15:81282181-81282203 TTGCCCTGGGGCCTTTGCGTTGG + Intronic
1132580863 16:684124-684146 CGGGCCGGGGGCCGTGGCGGAGG - Exonic
1135669262 16:24361391-24361413 CTGCCCGGGGTCTCCGGCGTTGG - Exonic
1135927290 16:26706778-26706800 CTGCCCTGGGGCCTTGGCACTGG + Intergenic
1136371647 16:29840486-29840508 CTGCCACGTGGCCTTGGCCTTGG + Intronic
1136639518 16:31550971-31550993 CTCCCCAGGGTCCCTGGCGTCGG - Intergenic
1136665243 16:31805557-31805579 CTCCCCAGGGTCCCTGGCGTCGG + Intergenic
1137436198 16:48455882-48455904 CTCCCCGGGGGGCTTGGCTGGGG - Intergenic
1138198859 16:55074272-55074294 CTTCCCGGGGGCCGTGGGGGTGG + Intergenic
1138346705 16:56324648-56324670 CAGCCCTGGGGCCTGGGCTTTGG - Intronic
1138503346 16:57462858-57462880 CTGCCCCGGGGCCCCGGCTTGGG - Intronic
1139778870 16:69334556-69334578 CTGCCCTGTGGCCCTGGCGCAGG - Exonic
1141169309 16:81681062-81681084 CTGTCCTGGGCCCTTGGCGATGG - Intronic
1142148438 16:88502355-88502377 CTGCCCAGGGGCCCGGGCGCCGG + Intronic
1142353721 16:89591357-89591379 CTGCCTGGGGGCCTCTGCGCTGG - Intronic
1142476715 17:193292-193314 CTGTCCTGTGGCCTTGGCATGGG + Intergenic
1142492776 17:289461-289483 CTGCTGGGCGGCCTTGGTGTGGG - Intronic
1142855075 17:2724612-2724634 CCGGCCGGGGCCCTTGGCGGCGG + Intergenic
1147383788 17:40070487-40070509 CTCCCAGGGGCCCTTGGTGTGGG + Intronic
1147744651 17:42687806-42687828 CTGCCAGGCGGCCACGGCGTGGG - Exonic
1150650206 17:67005261-67005283 CTGCCCAGGAGCCTTGGCTGGGG + Intronic
1151836066 17:76583669-76583691 CAGCCAGAGGGCCTTGGTGTTGG + Intronic
1152556083 17:81053944-81053966 GTGCCCGGGCCCCTTGGGGTGGG + Intronic
1152556168 17:81054230-81054252 GTGCCCGGGCCCCTTGGGGTGGG + Intronic
1152611731 17:81318208-81318230 CTGCCCCGGGACCTTGACCTTGG + Intronic
1152632044 17:81414761-81414783 CCGTCCCGGGGCCTTGGGGTTGG - Intronic
1152891417 17:82883697-82883719 CTGCCCCGGGGCATTTGTGTCGG + Intronic
1153942227 18:9988250-9988272 CGGCCCAGGGGCCTCGGCGCAGG + Intergenic
1157517300 18:48320206-48320228 TTGCCTGAGGGCCTTGGCCTGGG - Intronic
1157616216 18:48989160-48989182 CTGCCCGGGGGCTGTGGGTTGGG + Intergenic
1160729268 19:633378-633400 CAGCCCGGGGGCCACGGCGTGGG - Intronic
1160751743 19:737701-737723 CTGCCCCGGGGCCTTTGCACTGG - Intronic
1160780129 19:873814-873836 CGGCCTGCAGGCCTTGGCGTGGG + Intronic
1161149806 19:2701938-2701960 CTGCCGAGGGGGCTTGGAGTGGG - Intronic
1161273880 19:3404791-3404813 CTGCTCGGAGGCCTGCGCGTAGG - Intronic
1161302996 19:3551907-3551929 CTGCCCCCGGGCCTTTGCATGGG + Intronic
1161343043 19:3753118-3753140 CTGCCCTGGGGCTTTGGGGGAGG + Intronic
1161345427 19:3766794-3766816 CTGCCCCGGGGCCTTTGCACAGG - Intronic
1161397304 19:4051678-4051700 CAGCCCGGAGACCTTGCCGTGGG - Intronic
1161431298 19:4233766-4233788 CTGCCCCAGGGCCTTTGCATGGG + Intronic
1161442586 19:4300738-4300760 CTGCCCCAGGGCCTTTGCATGGG - Intronic
1161488325 19:4547880-4547902 CTGCCCGCGGGCCTTTGCACGGG + Intronic
1161619236 19:5289664-5289686 CTGCCCCCGGGCCTTTGCGTGGG + Intronic
1161630788 19:5354434-5354456 CTGCCCCAGGGCCTTTGCATGGG - Intergenic
1161646200 19:5454921-5454943 CTGCCCCAGGGCCTTTGCATGGG - Intergenic
1161698711 19:5783866-5783888 CAGCCCCGGGGCCTTGAGGTAGG + Exonic
1161719727 19:5896153-5896175 CTGCCCCAGGGCCTTTGCATGGG - Intronic
1163772153 19:19197653-19197675 GTTCCCGGGGGCCTTAGGGTGGG + Intronic
1164194490 19:22944136-22944158 TTGGCCTGGGGCCTTGGCCTGGG - Intergenic
1164794211 19:31013553-31013575 CTGGGCGGGGGCCTTGGGGCTGG - Intergenic
1167712311 19:51119948-51119970 CTCCCCAGGGGCTTTGGCTTAGG + Intergenic
1168340659 19:55621469-55621491 CAGCCCGTGGGCCTTGCCTTTGG + Exonic
926926820 2:17995785-17995807 CTGCCCTGAGGCCTGGGCCTGGG - Intronic
927048449 2:19303442-19303464 CTGCCAGGCGGAGTTGGCGTTGG - Intergenic
931868907 2:66439280-66439302 CTCTCCGAGGGCCTTGGGGTTGG + Intronic
932494631 2:72140273-72140295 CTGCCAGGGTGCCTGGGAGTGGG - Intronic
933678281 2:85077021-85077043 CTGCCCAGGAGCCTCGGAGTTGG + Intergenic
934174639 2:89567999-89568021 CTGCCCCAGGGCCTTTGCATGGG + Intergenic
934284956 2:91642349-91642371 CTGCCCCAGGGCCTTTGCATGGG + Intergenic
935192784 2:100792225-100792247 CTGCCCCTGGGCCTTTGCCTTGG - Intergenic
936881659 2:117259507-117259529 CTGCCCAGGGGAATTGGGGTAGG - Intergenic
937208455 2:120252371-120252393 CCGCCCGGGGGTCTTGGGGCGGG - Intronic
937217586 2:120322417-120322439 CTGCCCTGTGACCTTGGCATTGG + Intergenic
937883482 2:126885308-126885330 CTGCCCGGCGGCCTTCGAGTTGG + Intergenic
937987952 2:127647041-127647063 CAGCCCGGGGGCCTCAGCCTGGG - Intronic
939839994 2:147175227-147175249 CTGCTCTGGGGCCTTGGAGTTGG + Intergenic
947714086 2:232331196-232331218 TTGGCCGGGGGCCTAGGCCTGGG + Intronic
948046993 2:234952319-234952341 CTGCGCGGGTGCCTGGGCGTGGG + Intronic
948126313 2:235567155-235567177 CTGCCCGCTGGCCTGGGGGTGGG - Intronic
948600591 2:239105685-239105707 CTGCCCTCGGGCCTGGGCTTCGG + Intronic
948908115 2:240989461-240989483 CAGCCCGTGGGCCTTGGGTTTGG - Intronic
1170994267 20:21336932-21336954 CTGCCCCAGGGCCTTGGCACTGG - Intronic
1172994175 20:39057806-39057828 CTGCCCAGGGGCCTTAGAGATGG + Intergenic
1174868444 20:54161197-54161219 CTGCCCCAGGGCCTTTGCATGGG + Intronic
1175733773 20:61371596-61371618 CTGCCCGGTGGTCTTGGGGAAGG - Intronic
1175955797 20:62608456-62608478 CACCCCGGGGGGCTGGGCGTGGG + Intergenic
1176015508 20:62929271-62929293 CTGCCCGGTGGCCTCGGCGGGGG - Intronic
1179667010 21:42919903-42919925 CTGCCCGGGTACCTTGCCCTGGG + Intergenic
1179840792 21:44071907-44071929 CTGCCCTTGTTCCTTGGCGTGGG + Intronic
1183736348 22:39646855-39646877 GTGCCGGGGCTCCTTGGCGTGGG - Exonic
1183780377 22:39995308-39995330 CGGCGCGGGGGCCTTGGCCTTGG - Exonic
1183896984 22:40977387-40977409 CTGCCCCGGGGACTTGGTCTGGG - Intergenic
1184048487 22:41987408-41987430 CTCCCCAGGGGCCCTGGCCTGGG - Intronic
1184561122 22:45263495-45263517 CTCCCCTGGGGCCTGGGCGGTGG + Intergenic
1184922145 22:47613289-47613311 CTGCCACGGGGCCTTGGCGTGGG + Intergenic
1185111270 22:48901493-48901515 CTGCCCCGGTGCCTTGGGTTGGG + Intergenic
1185245694 22:49771632-49771654 CTGCCCCGGGGCCCTGGCCTTGG - Intergenic
1185287837 22:50010465-50010487 CTGCAGGGGGGCAGTGGCGTGGG + Intronic
1185374095 22:50474424-50474446 CTGCCCGGCCTCCTTGGGGTGGG - Intronic
950529568 3:13545450-13545472 CTGCCCTCGGGCCTGGGCCTGGG + Intergenic
950545351 3:13634866-13634888 CTGCCCCGTGGGGTTGGCGTGGG + Intronic
950550241 3:13661909-13661931 CTGCCTGGGGGCCTCTGCCTGGG - Intergenic
951323215 3:21271880-21271902 CTGCCCGGGGCCAGTGGCGCCGG + Intergenic
952319023 3:32258916-32258938 CTGTCCGGGGGCAGTGGGGTGGG - Intronic
953445131 3:42957185-42957207 CTGCCCGGGGGCCGGGGGGTTGG - Intronic
954225054 3:49175934-49175956 CTGCCTTGGGGCCTTGGGTTAGG + Exonic
955003827 3:54951458-54951480 CGGCCCGGGGGCAGTGGGGTGGG + Intronic
956214847 3:66838295-66838317 CTGCCCTGGGGCCTTTGCACAGG + Intergenic
956459210 3:69454539-69454561 CTGCCCGGGGCCGGTGGCGCCGG - Intronic
960699619 3:120427470-120427492 CTGCCCTGGGGACTTGGGATAGG + Intronic
961657663 3:128452340-128452362 CTGCCCCAGGGCCTTGGCACCGG + Intergenic
962457367 3:135577003-135577025 CTGCCTTGGGGCCTTGGCTGGGG + Intergenic
963589985 3:147245824-147245846 CTGCCCGGGGCCCGTGGGGCCGG + Intergenic
966248638 3:177837254-177837276 CTGGCCTGGGGCCTTGGCTGTGG + Intergenic
968873335 4:3252435-3252457 CTGCCCAGAGGCCCTGGGGTGGG - Intronic
982033677 4:151325430-151325452 CGGCCCGAGGGCGGTGGCGTGGG - Intronic
990249025 5:53893779-53893801 CTGTCCTGGAGCCATGGCGTGGG - Intronic
992732944 5:79690463-79690485 CTCCCCGGGGGCCTAGCAGTAGG + Intronic
997965531 5:138353044-138353066 CTCCCCGGGGGCCTTTGTGAGGG + Intronic
998095580 5:139394140-139394162 CGGCCTCGGGGCCTTGGCGGGGG + Exonic
1002616437 5:180459272-180459294 CTGCCCGGGGCCGGTGGCGCCGG - Intergenic
1004663302 6:17728863-17728885 CTGCCCAGGGCCTGTGGCGTGGG - Intergenic
1005725068 6:28639999-28640021 CTGCCCGGGGCCGGTGGGGTCGG + Intergenic
1006510269 6:34517580-34517602 CTGCCCCAGGGCCTTTGCATGGG + Intronic
1006817008 6:36858504-36858526 ATGCCCAGGGGCCTTGGGGGTGG - Intronic
1008013351 6:46491306-46491328 GTGCCCGCGGGCCTTTGCGTGGG + Exonic
1011794385 6:90936695-90936717 CTGCCCCGGTGCCTTGCCTTTGG - Intergenic
1014826204 6:126051033-126051055 CTGCCCTGGGGCTGGGGCGTGGG + Intergenic
1017626325 6:156352578-156352600 CTGCCCTGGGGCCCTGGCAAAGG - Intergenic
1018025880 6:159805258-159805280 CGGACCGGGGGCCTTGGGGCTGG + Intronic
1019330078 7:457171-457193 AGGCCCGGGGGTCCTGGCGTTGG - Intergenic
1019350280 7:551274-551296 CTTCCCTGGGGCCTTGTAGTGGG - Intronic
1021609600 7:22444570-22444592 CTGCCCGGGAGCCTCTGCCTTGG + Intronic
1022090080 7:27102262-27102284 CTGCCCGCGGGGCTCGGCTTGGG + Exonic
1026776617 7:73234913-73234935 ATGCCCGGGGGCTTTGGGGATGG + Intergenic
1027017468 7:74788283-74788305 ATGCCCGGGGGCTTTGGGGATGG + Intronic
1027070554 7:75157649-75157671 ATGCCCGGGGGCTTTGGGGATGG - Intergenic
1034979305 7:155466287-155466309 CTGGCCGGGGGCCCAGTCGTGGG - Intergenic
1038700581 8:29846111-29846133 ATGACGGGGGGCCTTGGCCTTGG + Intergenic
1038720258 8:30028581-30028603 CTCCCTGGGGTCCTTGGCCTGGG - Intergenic
1045627632 8:104074282-104074304 CTGCCTGGGTGGCTTGGGGTAGG + Intronic
1046948741 8:120000300-120000322 CTGGAGGGGGGCCTTGGGGTTGG - Intronic
1049338182 8:142097588-142097610 ATGTCTGGGGGCCTCGGCGTGGG + Intergenic
1049792706 8:144479334-144479356 CAGCCCGGGGGACTTGGGGCAGG - Intronic
1049844285 8:144792531-144792553 CTGCGCGGGGGCCCTGGAGGAGG - Exonic
1054777240 9:69133983-69134005 CTGTCCGAGGGACTTGGCTTGGG - Intronic
1055654924 9:78442177-78442199 CTGCCCCGGGGCGGTGGCGCCGG - Intergenic
1057277434 9:93683555-93683577 CTGCCTGAGGGCCTTGGCACAGG - Intergenic
1062526176 9:136978859-136978881 CTGCTCGGGGGATTGGGCGTGGG + Intronic
1062540470 9:137039719-137039741 CTCCCCGGGGGCCTCGAGGTCGG + Exonic
1185460551 X:331137-331159 CCGCACGGGGGCCTGGCCGTCGG - Intergenic
1194385126 X:93243089-93243111 TTGCCCCAGGGCCTTGGCCTGGG - Intergenic
1196860877 X:120026044-120026066 CTGCCCGGGGCCAGTGGCGCTGG + Intergenic
1198378370 X:136061472-136061494 CTGCCGGGAAGCCTTGGCCTTGG - Intergenic