ID: 1119383412

View in Genome Browser
Species Human (GRCh38)
Location 14:74242386-74242408
Sequence GCTTCGTTCTTCCTTGGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 147}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119383407_1119383412 23 Left 1119383407 14:74242340-74242362 CCTAATTTGTTTTCAGCCTCTTT 0: 1
1: 0
2: 4
3: 44
4: 493
Right 1119383412 14:74242386-74242408 GCTTCGTTCTTCCTTGGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 147
1119383409_1119383412 -3 Left 1119383409 14:74242366-74242388 CCCTCTCTGCGCTTTTCTATGCT 0: 1
1: 0
2: 0
3: 20
4: 288
Right 1119383412 14:74242386-74242408 GCTTCGTTCTTCCTTGGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 147
1119383405_1119383412 27 Left 1119383405 14:74242336-74242358 CCACCCTAATTTGTTTTCAGCCT 0: 1
1: 0
2: 0
3: 21
4: 224
Right 1119383412 14:74242386-74242408 GCTTCGTTCTTCCTTGGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 147
1119383406_1119383412 24 Left 1119383406 14:74242339-74242361 CCCTAATTTGTTTTCAGCCTCTT 0: 1
1: 0
2: 1
3: 42
4: 376
Right 1119383412 14:74242386-74242408 GCTTCGTTCTTCCTTGGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 147
1119383404_1119383412 28 Left 1119383404 14:74242335-74242357 CCCACCCTAATTTGTTTTCAGCC 0: 1
1: 0
2: 2
3: 17
4: 168
Right 1119383412 14:74242386-74242408 GCTTCGTTCTTCCTTGGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 147
1119383410_1119383412 -4 Left 1119383410 14:74242367-74242389 CCTCTCTGCGCTTTTCTATGCTT 0: 1
1: 0
2: 1
3: 18
4: 240
Right 1119383412 14:74242386-74242408 GCTTCGTTCTTCCTTGGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 147
1119383408_1119383412 7 Left 1119383408 14:74242356-74242378 CCTCTTTGCACCCTCTCTGCGCT 0: 1
1: 0
2: 1
3: 21
4: 222
Right 1119383412 14:74242386-74242408 GCTTCGTTCTTCCTTGGCCCTGG 0: 1
1: 0
2: 0
3: 9
4: 147

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119383412 Original CRISPR GCTTCGTTCTTCCTTGGCCC TGG Intronic
900365695 1:2311153-2311175 GCTTCCTTCTTCCCTGCCCAGGG + Intergenic
903847724 1:26288430-26288452 GGTTCCTTCTTCCTGGCCCCTGG - Intronic
904943013 1:34177876-34177898 GCTTCCTTCATCCTCGGCCCTGG + Exonic
905900660 1:41580312-41580334 GCTCCCTCCTGCCTTGGCCCTGG + Exonic
907152658 1:52303799-52303821 GCTTCAATCTGCTTTGGCCCAGG + Exonic
908418050 1:63932549-63932571 GCATCATTCTTCCTTGGCTTTGG - Intronic
908540365 1:65116454-65116476 GCTTCTTTCCTCCTTGTCCCAGG - Intergenic
909665949 1:78133584-78133606 GCTGCTTTCTGCCTTTGCCCAGG - Intronic
911499012 1:98662526-98662548 CTTTCGTTTTTCCTTGCCCCCGG + Intronic
911525515 1:98980160-98980182 GTTTCCTTCTTCCTATGCCCAGG + Intronic
915497886 1:156294230-156294252 GCTTCTTCCTTCCTAGGTCCAGG - Exonic
917670678 1:177270637-177270659 GCTTCCTTCTTTCCTGGACCTGG + Intronic
917930241 1:179817817-179817839 GCTTCCTTCACCCTCGGCCCAGG + Intergenic
919763865 1:201114384-201114406 GCTCCGTCCTTCCTTGCCGCAGG - Exonic
920605595 1:207381233-207381255 GCTTCCTTTTTCCTTGGTGCAGG - Intergenic
921183515 1:212650879-212650901 GCTTCTGTCTTCTTTGGACCTGG - Intergenic
921364571 1:214361523-214361545 GCTTTGTGCTTCCTTGGCTTGGG - Intronic
922783767 1:228273035-228273057 GCCTCGGTCTTCCAGGGCCCTGG - Intronic
1062858381 10:790946-790968 GCCTCTTTCTTCCTGGCCCCTGG - Intergenic
1063663694 10:8049866-8049888 GCCTCCTTCCTCCTTAGCCCCGG - Intergenic
1064965480 10:21011710-21011732 GGTGTGTTCTTCCTTGGCTCAGG + Intronic
1066623055 10:37378805-37378827 CCTTCATTCATGCTTGGCCCTGG - Intronic
1073217617 10:101845053-101845075 GCTTGGATCTCCCTTGGCTCTGG + Intergenic
1074562167 10:114544280-114544302 TCTTACTTCTTCCTTGGACCTGG + Intronic
1078445611 11:11402923-11402945 GCTTCTTTCTTCTCTGCCCCAGG + Intronic
1083634301 11:64111857-64111879 GCCTCCTGCTTCCTTTGCCCAGG - Intronic
1084024261 11:66438106-66438128 CCTCTGTTCTTCCTCGGCCCTGG - Intronic
1086439234 11:86811928-86811950 GCTTCCTTCTTACTTTGCCTGGG + Intronic
1088135715 11:106553091-106553113 ACCTCGTTCTTCCTGGTCCCAGG + Intergenic
1088885262 11:114001115-114001137 GCTTCGTTCATCCTCTGCCCAGG - Intergenic
1089007993 11:115108588-115108610 GCTTTGTTTTTCTTTGGTCCTGG - Intergenic
1089346693 11:117795897-117795919 GCTTCTCTCTCCCTTTGCCCTGG - Intronic
1091280341 11:134378145-134378167 AGTTCGTTCTTCTTGGGCCCGGG + Intronic
1091584150 12:1806394-1806416 GCTTGGCTCTTTCTTGGCACCGG - Intronic
1091681974 12:2533696-2533718 GCCTCGCTCTTCCTTGTCCCAGG + Intronic
1092279103 12:7086300-7086322 CCCTCTTTCTTTCTTGGCCCAGG + Intronic
1093848801 12:24010543-24010565 TTATCTTTCTTCCTTGGCCCTGG - Intergenic
1096121699 12:49092860-49092882 CCTTCTTTCCTCCTTGGCCGTGG - Intronic
1096218002 12:49809068-49809090 GTTTCCTCCTTCCTCGGCCCTGG - Intronic
1096239854 12:49953981-49954003 GATCCCTTCTTCCTGGGCCCTGG - Intronic
1099952933 12:89324188-89324210 GCATCTTTATTCCTGGGCCCTGG + Intergenic
1100303874 12:93332847-93332869 GCTGTGTTCTTCCTTGAGCCTGG + Intergenic
1101011414 12:100454203-100454225 GCTTTGTTCTTCCTAGGACTTGG - Intergenic
1101483391 12:105124814-105124836 GTTTAATTCTTCCTAGGCCCAGG + Intronic
1115194222 14:30778509-30778531 CCTTCCTTCTGCCTGGGCCCTGG + Intergenic
1119383412 14:74242386-74242408 GCTTCGTTCTTCCTTGGCCCTGG + Intronic
1122628182 14:103094803-103094825 GCTGTGTTCTTCCTGGGCCAAGG + Intergenic
1122885061 14:104707214-104707236 GCTCCCTTCTCCCTTGACCCTGG + Intronic
1128791041 15:70434171-70434193 GCTTCTCTTTGCCTTGGCCCTGG - Intergenic
1129152363 15:73697040-73697062 CGTTCGTTCATCCTTAGCCCTGG + Intronic
1132556451 16:574852-574874 GATGCGCTCTTCCTGGGCCCGGG + Intronic
1134238491 16:12486432-12486454 TCTTCCTTCTTCCTTGTCCTGGG + Intronic
1134690370 16:16187205-16187227 GCTTCGGTTTTCCTAGGCCCGGG - Exonic
1137702903 16:50510009-50510031 TCTTTGTTCTTCCCTAGCCCAGG + Intergenic
1139312473 16:66039421-66039443 GCTTCCTGCTGCCATGGCCCTGG + Intergenic
1143264494 17:5625950-5625972 TCTTCGCTGTTCCTTAGCCCTGG - Intergenic
1144958509 17:19031879-19031901 GCTTCTTCCTGCCTGGGCCCAGG - Intronic
1144976650 17:19142645-19142667 GCTTCTTCCTGCCTGGGCCCAGG + Intronic
1146903977 17:36606379-36606401 GCTGGGCTCTTCCTTGGCCAGGG + Intronic
1148195607 17:45710518-45710540 GTTTCTTCCTTCCTTTGCCCGGG + Intergenic
1148670365 17:49405524-49405546 GCTTCTGTTTTCCTTGGCCTTGG - Intronic
1149429913 17:56589362-56589384 TCTTCTTGCTTCTTTGGCCCTGG - Intergenic
1150499554 17:65637499-65637521 GCTCCGTTGCTCTTTGGCCCAGG + Intronic
1151193549 17:72415807-72415829 GCATGGTTCTTCCTAGCCCCTGG - Intergenic
1151194691 17:72423201-72423223 GCTTCTTTCTCCCAGGGCCCGGG + Intergenic
1151387927 17:73766623-73766645 GCTTCATTCTTCCATGGCAAAGG + Intergenic
1152867943 17:82735462-82735484 GCTTCGCGCTTCCTGCGCCCGGG - Intergenic
1158940922 18:62405420-62405442 GGTTCGTGCTCCCGTGGCCCTGG + Intergenic
1160759632 19:776730-776752 ACCTCGTTCTCCCTGGGCCCCGG + Intergenic
1161066466 19:2240921-2240943 GCTCCGCTCCTCCTGGGCCCTGG + Intronic
1162912565 19:13856631-13856653 GCCTGGTTCCTCCTTGGCCTTGG - Intergenic
1162935393 19:13979229-13979251 TCTTCTTTCTTGCGTGGCCCTGG - Intronic
1167866784 19:52335418-52335440 CGTTCGTTCTGCCTTGGGCCAGG + Intergenic
1168726120 19:58583096-58583118 GCTCTGTTCTTCCCGGGCCCTGG + Intergenic
930093870 2:47551978-47552000 CCTTCCTTCTTGTTTGGCCCTGG + Intronic
933041224 2:77469227-77469249 GCTTGCTGCTTCCTTTGCCCAGG - Intronic
933587558 2:84195846-84195868 GTTTTATTCTTCCTGGGCCCTGG + Intergenic
935350953 2:102151564-102151586 ACTGCTTTCTTCCCTGGCCCAGG + Intronic
936490829 2:112970774-112970796 GCTTCGATCTTCCTTAGACCTGG - Intergenic
937095357 2:119231992-119232014 GCTTCATTCTTACTGGGCCTGGG - Intronic
937980981 2:127615205-127615227 CCCTCCTCCTTCCTTGGCCCAGG - Intronic
940149321 2:150581660-150581682 GCTACTTTCTTTCTTGCCCCAGG - Intergenic
940918850 2:159286406-159286428 GGTTCGTGCACCCTTGGCCCGGG - Exonic
942011798 2:171770788-171770810 TCTTCTTTTTTTCTTGGCCCTGG - Intergenic
948033605 2:234839939-234839961 GCCTCTTTCTGCCTTGGTCCTGG - Intergenic
1170553265 20:17495190-17495212 GCTTTGTTGCTCCATGGCCCAGG + Intronic
1171041580 20:21769083-21769105 GCATCTTTCTTCCTTGGACAAGG + Intergenic
1173223305 20:41146602-41146624 GTTTAGTTCTTCCTGGGCACAGG + Intronic
1174168723 20:48603452-48603474 GCTGCATCCTTCCCTGGCCCTGG + Intergenic
1175038242 20:56020774-56020796 GCTGCGGTTTTCTTTGGCCCAGG + Intergenic
1176098785 20:63355813-63355835 GCTTCTTCCTTCCTGGGCCTGGG + Intronic
1177262653 21:18750410-18750432 GCCTCATTCTTCCTAGGCACAGG + Intergenic
1178901679 21:36604181-36604203 TCTTCCTTCCTCCTTTGCCCTGG + Intergenic
1180046510 21:45308762-45308784 GCTCTGTTCTTCCTGAGCCCAGG + Intergenic
1180096379 21:45557148-45557170 GCTCCGTTCTTCCTGAGTCCTGG - Intergenic
1181615300 22:24050077-24050099 CCTCTGGTCTTCCTTGGCCCTGG + Intronic
1182270638 22:29151068-29151090 GTTTGATTCTTCCTTGACCCAGG - Intronic
950499294 3:13353660-13353682 GCTTCCTTCTTCCTGGTCTCAGG - Exonic
953331092 3:42053518-42053540 GCTTCTTTCCTCCTGGACCCTGG + Intronic
954849482 3:53588323-53588345 CCTTCTTTCTTGCTTGCCCCTGG + Intronic
956020744 3:64930889-64930911 ACTTGTTTATTCCTTGGCCCTGG + Intergenic
958065091 3:88534594-88534616 GCTATGTCCTTCCTTTGCCCAGG + Intergenic
959327673 3:104957345-104957367 ACTTCATTCTTCTTGGGCCCAGG - Intergenic
960427869 3:117531264-117531286 GCTTCATTCTTCCCCAGCCCAGG - Intergenic
967702309 3:192607363-192607385 TCTTCGTTCTTCCTTATGCCAGG - Intronic
968424069 4:509758-509780 GTTTCGTTCTGCATTAGCCCTGG + Intronic
969453008 4:7285688-7285710 GCCTCGTTCTTCCTTCTCGCTGG + Intronic
969676522 4:8617379-8617401 GCATCCTCCTTCCCTGGCCCCGG - Intronic
974549037 4:63348951-63348973 CCTTTGTTCTTCCTTGCCCTGGG + Intergenic
978677693 4:111338769-111338791 GTTTAGTGCTTCCTTGGGCCTGG - Intergenic
986640277 5:9864986-9865008 TCTTCTTTCTTCCTTGGGTCAGG + Intergenic
987599423 5:20046554-20046576 GCTTTTTTCTTGCTTGGCCCTGG - Intronic
988962596 5:36384954-36384976 ACTTCCTTCCTCCTGGGCCCGGG + Intergenic
990825201 5:59892109-59892131 GCTCCTTTCTTCCCTGTCCCAGG - Intronic
992579634 5:78158373-78158395 GCCTCAACCTTCCTTGGCCCAGG - Intronic
996823561 5:127656624-127656646 CCTCCGTTCTCCCTTGGCTCAGG + Intronic
998865249 5:146492942-146492964 CCTGCGTTCTTCCTCTGCCCTGG - Exonic
1001656827 5:173357398-173357420 GATTCGTTTTCCCCTGGCCCTGG + Intergenic
1002048593 5:176556102-176556124 ACCTGGTTCTTCCCTGGCCCAGG + Intronic
1005022941 6:21434858-21434880 GCCTCGATCTTCCTGGGCTCAGG - Intergenic
1011651299 6:89508934-89508956 GCATCTTCCCTCCTTGGCCCAGG - Intronic
1017131440 6:151111541-151111563 GCTTCGACCTTCCTGGGCTCAGG + Intergenic
1019289056 7:241115-241137 GCTGCTTTCTTCCTTGCCCCTGG + Intronic
1022198419 7:28092776-28092798 GCCTCGATCTTCCCAGGCCCAGG - Intronic
1023987047 7:45102818-45102840 GATTCCTCCTTCCTTGTCCCAGG - Intronic
1025998211 7:66541818-66541840 GCCTGGTTCTTCCTTTTCCCAGG - Intergenic
1027916751 7:84334571-84334593 GTTTTGCTCTTCCTTGGTCCTGG + Intronic
1028941489 7:96526756-96526778 GCTTTGTTCTTCCCAGCCCCTGG + Intronic
1029546111 7:101211529-101211551 GCTTGGGTCTACCTGGGCCCCGG + Intronic
1034775876 7:153826156-153826178 GCTTTGTTCTTCCTTGGAGATGG - Intergenic
1039321479 8:36436609-36436631 GCTTCTTCCTTCATTGGCTCAGG + Intergenic
1039595005 8:38784119-38784141 GCTTCGTTCTTACCTGGTACAGG - Intronic
1041381576 8:57258702-57258724 GGTCTGCTCTTCCTTGGCCCAGG - Intergenic
1042886146 8:73554341-73554363 ACCTCTTTCTTCATTGGCCCCGG + Intronic
1044301379 8:90587368-90587390 GTTTTGTTCTTTCTTTGCCCAGG - Intergenic
1044606869 8:94055550-94055572 GCCTCTTTCTTCCTTGTCTCTGG + Intergenic
1047648623 8:126895910-126895932 GCTTCATTATTCCATTGCCCGGG + Intergenic
1048180038 8:132185949-132185971 GCTTTGCTTTTCCTTGGGCCTGG + Intronic
1048471998 8:134712458-134712480 GCTTCCTTCTTGCCTGGCCTCGG - Intronic
1048833096 8:138495658-138495680 TCTTCCTTCTTCCGGGGCCCTGG + Intronic
1049675770 8:143888231-143888253 GCTTCGTGCTGGCCTGGCCCTGG - Intergenic
1051150528 9:14074151-14074173 GCTTTCTTTTTCCTTGGCTCAGG - Intergenic
1052496673 9:29234858-29234880 CCTTCTTTCTTCTTTAGCCCCGG + Intergenic
1053154751 9:35769202-35769224 GGTTCTTTCTTCCTTGGCAATGG - Intergenic
1055539434 9:77287281-77287303 GCCTCGACCTTCCCTGGCCCAGG + Intronic
1056386211 9:86099341-86099363 GCTTCCTCCCTCCTTTGCCCAGG - Intronic
1056856577 9:90134868-90134890 TCTTCCTGCTTCCTTGTCCCGGG - Intergenic
1057488052 9:95501570-95501592 GCCTCCTTCTTCCTTGACGCTGG + Intronic
1058196591 9:101984464-101984486 ACTTTGTTCTTCATTGGCTCTGG - Intergenic
1059754415 9:117279120-117279142 GCTGCCTTCTTCCATGGTCCAGG + Intronic
1061008676 9:127942715-127942737 GCTCCGTTGTTCCCTTGCCCTGG - Exonic
1189200642 X:39193043-39193065 TCCTAGTTCTTCCATGGCCCAGG + Intergenic
1193505441 X:82336804-82336826 ACTTCGTTCTTCCTAGGTGCAGG + Intergenic
1193981661 X:88188122-88188144 GCTGCGATCTTCTTTGGCCCAGG - Intergenic
1195213391 X:102672028-102672050 TCTTTGTTTATCCTTGGCCCAGG + Intergenic
1198386417 X:136133386-136133408 ACTTTGTTCTTCCCTTGCCCTGG - Intergenic
1200322628 X:155205762-155205784 GCTTAGTTCTTTCTAGGCACAGG + Intronic