ID: 1119384126

View in Genome Browser
Species Human (GRCh38)
Location 14:74246542-74246564
Sequence CCCATTACCCTCCACCCAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 99
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 93}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119384123_1119384126 -8 Left 1119384123 14:74246527-74246549 CCATGGGGGCCTGGACCCATTAC 0: 1
1: 0
2: 0
3: 13
4: 119
Right 1119384126 14:74246542-74246564 CCCATTACCCTCCACCCAATTGG 0: 1
1: 0
2: 0
3: 5
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119384126 Original CRISPR CCCATTACCCTCCACCCAAT TGG Intronic
900600937 1:3502419-3502441 CCCACTCCCCTCCACCCAGCTGG + Intronic
903279039 1:22239591-22239613 CCCTCTACCCTCCAGCCTATCGG + Intergenic
903327423 1:22577447-22577469 CCCACTTCCCTCCACCCTACAGG - Intronic
903846106 1:26280641-26280663 CCCATTCCCCTCCACACTAGGGG - Intronic
907328481 1:53656251-53656273 CCCATTCCACTCCACCCCAGAGG + Intronic
908807859 1:67949344-67949366 CCCCTTGCCCTGCACCCAGTAGG + Intergenic
909401597 1:75238425-75238447 CCTATAACCCTTAACCCAATAGG + Intronic
909861366 1:80609910-80609932 CCCCTTGCCCTCCACCCCACCGG + Intergenic
913202557 1:116507050-116507072 GCCATTACACTCCAGCCTATGGG + Intergenic
918406106 1:184213262-184213284 CTCATTTCCCTCCTCCCAGTTGG + Intergenic
1064248625 10:13689948-13689970 CCCAGTACCCAACACCCAATAGG - Intronic
1067898595 10:50213848-50213870 CCCAGTCAACTCCACCCAATGGG - Intronic
1071564692 10:86665632-86665654 CCGATGACCCTCCACACACTGGG - Intronic
1076043481 10:127271680-127271702 CCCATTACCCAACACACAGTAGG + Intronic
1080573629 11:33578829-33578851 CCCATTGCCCTCCTCACATTGGG + Intronic
1081550747 11:44109661-44109683 CCCATTACCCTCTACATTATAGG - Intronic
1082957936 11:58891595-58891617 CCCCTTTCCCTCCACCCTCTAGG + Intronic
1083626855 11:64076265-64076287 CCCATGACCCTCCACTGCATGGG + Intronic
1085439534 11:76546078-76546100 ATCATTACCCTCCACCCACATGG + Exonic
1086879620 11:92138145-92138167 CCCATTGCCATCCACCCAGTGGG + Intergenic
1089458316 11:118638620-118638642 TCCCTTACCCTACAACCAATGGG - Intronic
1102202384 12:111066582-111066604 CCCCTCACCCCTCACCCAATGGG - Intronic
1119384126 14:74246542-74246564 CCCATTACCCTCCACCCAATTGG + Intronic
1120884728 14:89442810-89442832 CACATTAGCCTACACCCAACTGG + Intronic
1122594362 14:102879012-102879034 CCCATCACCCTCCACTCACTGGG - Intronic
1122902108 14:104786252-104786274 CCAAGTGCCCTCCACCCAGTGGG + Intronic
1127683458 15:61319310-61319332 CTCATTACCCTCCATCAAATGGG - Intergenic
1129198376 15:73984215-73984237 ACCAGTACTCTCCTCCCAATGGG - Intronic
1129244036 15:74269073-74269095 CCCATCACCATCCACCCCCTAGG + Intronic
1133777662 16:8910215-8910237 CCCATTTCCCTTCATCCAAGCGG + Intronic
1139349827 16:66327970-66327992 CCCAGTGCCTGCCACCCAATGGG - Intergenic
1143563348 17:7707936-7707958 CACCTTACCCTCCTCCCCATAGG + Exonic
1147920526 17:43913844-43913866 CCCATTCCCTGCCACCCCATAGG + Intergenic
1148787220 17:50151191-50151213 CCCCTTCCCCTCCACCCGAACGG + Intergenic
1148901754 17:50883922-50883944 CCCGTCACCCTGCACCCACTGGG + Intergenic
1151353968 17:73547565-73547587 CCCATTCCCCACCTCCCAATAGG + Intronic
1154509463 18:15080827-15080849 ACCATTACCCTAAACTCAATGGG - Intergenic
1161246461 19:3255143-3255165 CCCATCCCCCTAGACCCAATGGG + Intronic
1161248765 19:3269579-3269601 CCCATTCCCCACCCCCCAAGGGG + Intronic
1162768957 19:12937732-12937754 CCCTTTACCCTCCTCTCAACCGG - Intergenic
1163578063 19:18122142-18122164 CCCATGACCCCCCACCCCCTGGG - Intronic
1163713825 19:18862789-18862811 GCCATTACACTCCAGCCACTGGG + Intronic
1165585796 19:36915118-36915140 CCCATTACCCACCACACATGAGG + Exonic
925296169 2:2779087-2779109 CTCATTACCTTCCTCCAAATTGG + Intergenic
929713240 2:44285860-44285882 CCAAATACCCCCCACCCCATTGG - Intronic
930696723 2:54419208-54419230 CCCCTCACCCCCCACCCAACAGG - Intergenic
932607779 2:73176162-73176184 CCCCTTCCCCTCGACCCACTAGG - Intergenic
935238593 2:101158685-101158707 CACAGTGCCTTCCACCCAATGGG + Intronic
935959006 2:108405394-108405416 CCCATCTCCATCCATCCAATGGG - Intergenic
1168780049 20:481485-481507 CCCCCCACCCCCCACCCAATTGG + Exonic
1176788617 21:13290998-13291020 ACCATTACCCTAAACTCAATTGG + Intergenic
1178019962 21:28396394-28396416 TCCCTTACACTCCACCCCATAGG - Intergenic
1184109260 22:42385412-42385434 CCCATTGCCCTCCAGCCACATGG + Intronic
1184940241 22:47759699-47759721 CTCATTTCCCTCCATCCTATGGG - Intergenic
962437047 3:135376492-135376514 CCCATTTTCCTCCTCCCCATAGG - Intergenic
965462134 3:168979084-168979106 CCCCCAACCCTCCACCCAACAGG + Intergenic
966334797 3:178856138-178856160 GCCATTCCCCATCACCCAATGGG + Intergenic
967329289 3:188274540-188274562 TCCATGCCCCTCCTCCCAATGGG - Intronic
967384706 3:188899964-188899986 CCCAGTTACCTCCACACAATTGG + Intergenic
977169545 4:93743753-93743775 CCCATTAGGCCCCACCTAATGGG + Intronic
983156722 4:164356960-164356982 CCTCCTACCCTCCACCCACTGGG - Intronic
984075853 4:175178849-175178871 CCCACTCCCCACCACCCAACAGG + Intergenic
987797830 5:22653028-22653050 CCCATAAACATCCACCAAATGGG + Intronic
990304034 5:54477522-54477544 CCCCTTTCCCCCCACCCAACAGG - Intergenic
992225784 5:74618791-74618813 CCCACTACCCACTACCAAATGGG - Intergenic
992650647 5:78855844-78855866 TCCATTACCCTAACCCCAATTGG - Intronic
994643256 5:102436449-102436471 CTCATTTCCCTCCAACCAAAAGG + Intronic
1001922839 5:175613978-175614000 CCCAATGCCCTCCACCCAGCAGG - Intergenic
1004528181 6:16428841-16428863 CCCATTAACCTCTCCCCACTTGG - Intronic
1006255576 6:32829664-32829686 CCCATGGCCCTCCTCCCACTGGG - Intronic
1008428991 6:51392621-51392643 TCAATTATCCTCCACCCCATTGG + Intergenic
1013163237 6:107566372-107566394 CCCATTCCCCTCTCCCCAAGGGG + Intronic
1016275553 6:142348108-142348130 CCCATTACCATGCAGCTAATGGG - Intronic
1022230142 7:28406459-28406481 CCCATTTCCCTCCACAGAACAGG - Intronic
1022280562 7:28904753-28904775 TCCATTACCCTCCAGACATTTGG + Intergenic
1030710851 7:112747407-112747429 CCAATCACCTCCCACCCAATAGG - Intergenic
1032708031 7:134439113-134439135 CACATTCCCCTCCACCCATGAGG - Intergenic
1035040641 7:155924488-155924510 CCCATGACCCTCACCCCACTAGG - Intergenic
1035403469 7:158583854-158583876 CTCATTACCATCCAACCAAACGG + Intronic
1037287185 8:17313910-17313932 GCCAATAACCCCCACCCAATGGG + Intronic
1037598081 8:20371105-20371127 CCCCTTACACTCCAGCCATTAGG - Intergenic
1038596368 8:28890235-28890257 CCCCTTTCCCTCCTCCCAAAGGG + Intronic
1039545488 8:38407863-38407885 CCCAAATCCCTTCACCCAATTGG - Intronic
1040484217 8:47854948-47854970 CCCACCACCCTCTACCCCATGGG + Intronic
1042112193 8:65392446-65392468 TCCAGTACCTTCCACCTAATAGG + Intergenic
1044297657 8:90546872-90546894 CTCCTTACCCTCCACTCACTGGG - Intergenic
1049321635 8:141999890-141999912 ACCATGACACTCCACCCAAGGGG + Intergenic
1050181248 9:2924979-2925001 CCCAATACCCACCAGCCTATAGG + Intergenic
1053353928 9:37430940-37430962 CCCATTATCCTCCACCACAAAGG + Intronic
1055287020 9:74739623-74739645 GCCATTATCCTCAACCCAAAGGG - Intronic
1056453072 9:86735280-86735302 TCCATCTCCCTCCACCCATTGGG + Intergenic
1059046709 9:110876968-110876990 CCCATTACACCTCACCTAATGGG + Intronic
1060011911 9:120051063-120051085 TCCATTACCTTCCACCCCAGAGG - Intergenic
1060013678 9:120067400-120067422 CCCATTACCCCCCAGGCCATGGG + Intergenic
1186503958 X:10075071-10075093 CCCAGTGCCCACCACCCAACAGG - Intronic
1189265889 X:39715877-39715899 CCCTTTACCCACCTCCCACTGGG - Intergenic
1190589892 X:51989196-51989218 CCCCTTACCCACCCCCCAACAGG + Intergenic
1197822522 X:130555440-130555462 CCCATTTCCCTTCCCCCAAAAGG + Intergenic
1200330240 X:155288143-155288165 CCCCATACTCTCAACCCAATAGG - Intronic