ID: 1119388846

View in Genome Browser
Species Human (GRCh38)
Location 14:74276555-74276577
Sequence GCTGCCAGGACAGCTAGAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119388841_1119388846 2 Left 1119388841 14:74276530-74276552 CCCATGTTTGACGACCAGGTCTG No data
Right 1119388846 14:74276555-74276577 GCTGCCAGGACAGCTAGAGTGGG No data
1119388835_1119388846 28 Left 1119388835 14:74276504-74276526 CCCTATGCCTGAGGCTCCTTGCT No data
Right 1119388846 14:74276555-74276577 GCTGCCAGGACAGCTAGAGTGGG No data
1119388837_1119388846 21 Left 1119388837 14:74276511-74276533 CCTGAGGCTCCTTGCTAGCCCCA No data
Right 1119388846 14:74276555-74276577 GCTGCCAGGACAGCTAGAGTGGG No data
1119388842_1119388846 1 Left 1119388842 14:74276531-74276553 CCATGTTTGACGACCAGGTCTGC No data
Right 1119388846 14:74276555-74276577 GCTGCCAGGACAGCTAGAGTGGG No data
1119388840_1119388846 3 Left 1119388840 14:74276529-74276551 CCCCATGTTTGACGACCAGGTCT No data
Right 1119388846 14:74276555-74276577 GCTGCCAGGACAGCTAGAGTGGG No data
1119388838_1119388846 12 Left 1119388838 14:74276520-74276542 CCTTGCTAGCCCCATGTTTGACG No data
Right 1119388846 14:74276555-74276577 GCTGCCAGGACAGCTAGAGTGGG No data
1119388836_1119388846 27 Left 1119388836 14:74276505-74276527 CCTATGCCTGAGGCTCCTTGCTA No data
Right 1119388846 14:74276555-74276577 GCTGCCAGGACAGCTAGAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119388846 Original CRISPR GCTGCCAGGACAGCTAGAGT GGG Intergenic
No off target data available for this crispr