ID: 1119392113

View in Genome Browser
Species Human (GRCh38)
Location 14:74297941-74297963
Sequence GTCATCCCGCAGCACGTTGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 45
Summary {0: 1, 1: 0, 2: 1, 3: 0, 4: 43}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119392111_1119392113 -7 Left 1119392111 14:74297925-74297947 CCTACGGGTTATCGATGTCATCC 0: 1
1: 0
2: 0
3: 1
4: 12
Right 1119392113 14:74297941-74297963 GTCATCCCGCAGCACGTTGAGGG 0: 1
1: 0
2: 1
3: 0
4: 43
1119392105_1119392113 27 Left 1119392105 14:74297891-74297913 CCACACAGAGTGTAGAAAGGACT 0: 1
1: 0
2: 1
3: 11
4: 147
Right 1119392113 14:74297941-74297963 GTCATCCCGCAGCACGTTGAGGG 0: 1
1: 0
2: 1
3: 0
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119392113 Original CRISPR GTCATCCCGCAGCACGTTGA GGG Exonic
900177685 1:1298087-1298109 GTCATCCACCACCACGGTGAGGG + Exonic
902021033 1:13345637-13345659 GTGTTCCCCCAGCACGTTTATGG - Intronic
903598626 1:24516710-24516732 CTCAGCCCACAGCACGTGGATGG + Intronic
903643573 1:24876648-24876670 GTCTTCCAGCTCCACGTTGAAGG - Intergenic
905799143 1:40832307-40832329 GTCAGCCAGCAGCATCTTGAGGG - Intronic
913264266 1:117028827-117028849 GTCAGACTGCAGCAAGTTGAGGG + Intronic
1065629607 10:27664619-27664641 GCAATCCCACAGCACTTTGAGGG - Intergenic
1066687447 10:37994257-37994279 GTCATCCCCCAGCTGGATGAGGG + Intergenic
1073785364 10:106883227-106883249 GTCATTCAGAAGCACTTTGAAGG - Intronic
1076612297 10:131733866-131733888 GTCCACCCGCAGCGCATTGAGGG + Intergenic
1077036611 11:498516-498538 CTCATCCCCCAGCTCGTTGCCGG + Exonic
1078474791 11:11621358-11621380 GTCATCAAGCAGCACATTCAAGG - Exonic
1083816037 11:65133006-65133028 GTCATCCCGAAAAACGGTGAAGG + Exonic
1089730371 11:120515216-120515238 CTCTTCCAGCAGCACCTTGAAGG - Intronic
1092243377 12:6849353-6849375 GTCATCCTGCAGGATGGTGAGGG + Exonic
1115962569 14:38852112-38852134 GTGAGCCCTCAGCACGTTCAAGG + Intergenic
1119392113 14:74297941-74297963 GTCATCCCGCAGCACGTTGAGGG + Exonic
1131178271 15:90223650-90223672 GACATCCTGCAGCACGTTGAAGG - Exonic
1139795583 16:69480844-69480866 GACATTCCCCAGCACGTTGCTGG + Intergenic
1143408715 17:6695866-6695888 CTCCTCCTGCAGCACCTTGAGGG + Exonic
1151485150 17:74394354-74394376 GTCATCCTGGAGCTCCTTGAAGG - Intergenic
1151982968 17:77525170-77525192 CTCATCCCGCTTCACGCTGAAGG + Intergenic
1161605996 19:5215288-5215310 GTCATCCTCCAGCCCATTGAAGG - Exonic
1161774307 19:6250424-6250446 GTCATCCCTCAGAACTGTGAGGG + Intronic
1166375116 19:42323694-42323716 GCCTTCCCGCAGCACGTCTATGG + Exonic
1168279270 19:55295596-55295618 GTCATCCAGGAGCACCTGGAGGG + Intronic
1179568764 21:42265575-42265597 GTCCTCCCCTAGCACGTTCAGGG + Intronic
955368755 3:58333014-58333036 GTCGTCCAGCAGCACCTTGCCGG - Exonic
959336784 3:105077277-105077299 GTCATCCCAAAACATGTTGAAGG - Intergenic
966080326 3:175992407-175992429 GTAGTCCCACAGCACTTTGAGGG + Intergenic
975824771 4:78308132-78308154 GCCATCTCTCAGCACGTGGAGGG - Exonic
976860444 4:89659367-89659389 GGCATCCCTCAGCACTTTAAAGG - Intergenic
984052998 4:174890377-174890399 GTCATCACGCAGTCCATTGAGGG + Intronic
1001087704 5:168713211-168713233 ATCTTCCCACAGCACGTTGGAGG + Intronic
1001787137 5:174423567-174423589 GTCTTCCAGCAGCACCTGGAAGG + Intergenic
1021692925 7:23247849-23247871 GTCAGCGCGCAGCACGTTCCCGG + Intronic
1023252462 7:38280136-38280158 GTCATCCTGCAGCAGGGGGAAGG - Intergenic
1029887779 7:103890965-103890987 GTAATCCCTCAGGAGGTTGAGGG + Intronic
1036741272 8:11363889-11363911 GTCATCCTCCAGCACTTTCAAGG + Intergenic
1046621455 8:116532902-116532924 GCCATCCCTCAGCAGGTTGTTGG - Intergenic
1048610267 8:136014785-136014807 GGTATCCTGCAGCACGTTGTGGG - Intergenic
1055069270 9:72149633-72149655 GTGATCCCGCAGCACCTCCATGG - Exonic
1055284794 9:74716859-74716881 GTCATGCCTCAGGACGTTAATGG - Intergenic
1062268484 9:135698280-135698302 GTCCTCCGGCATCACGGTGATGG - Intronic
1191682490 X:63855543-63855565 TTCTTCCTGCAGCAGGTTGAGGG - Intergenic