ID: 1119397043

View in Genome Browser
Species Human (GRCh38)
Location 14:74334181-74334203
Sequence CCTGGAAGCCAAAGCCAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 436
Summary {0: 1, 1: 1, 2: 12, 3: 40, 4: 382}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119397043 Original CRISPR CCTGGAAGCCAAAGCCAAGA AGG Intronic
900300686 1:1975510-1975532 CCTCGATGCCAAAACCAAGTGGG - Intronic
900390974 1:2433780-2433802 CCAGGCACCCAAAGCCACGAAGG - Intronic
900605663 1:3522535-3522557 CCTGGGAGGCAAATCCCAGAAGG + Intronic
902082591 1:13831313-13831335 CCTTGAAGCCCAAGACAAGGAGG + Intergenic
902629607 1:17696890-17696912 GCTGGTAGCCACAGCCAGGAAGG - Exonic
902773229 1:18658293-18658315 CCTCGAAGACACAGCCAGGATGG - Intronic
902944241 1:19823154-19823176 CCTGGTGGCCAAAGCAAAAATGG - Intergenic
903072835 1:20735992-20736014 ACTGAAAACCAGAGCCAAGATGG + Intergenic
903222600 1:21877169-21877191 CCTGGCAGCCAAAGAGAAAAGGG - Intronic
903415531 1:23179986-23180008 CCTGGCAGTCAAAGCAAAGAGGG + Intergenic
904627900 1:31818014-31818036 CCTGAAATCCCAGGCCAAGATGG - Intergenic
905901576 1:41584910-41584932 TGTGGGAGCCAAACCCAAGACGG + Exonic
906270347 1:44472908-44472930 CCGAGAAGCAAAAGGCAAGAAGG - Intronic
906613269 1:47218173-47218195 CCTCGAAGGCAGAGCCTAGAGGG + Exonic
907316987 1:53578620-53578642 CCTGGTAGCCAAAGCAAAGAGGG - Intronic
908308122 1:62846258-62846280 CCTGGAAGCCAATGTGAAGAAGG - Intronic
910804569 1:91177768-91177790 GCTGGGAGCCCAATCCAAGAGGG + Intergenic
912861427 1:113217189-113217211 GCAGGAAGACAGAGCCAAGAGGG - Intergenic
913240257 1:116824133-116824155 ACTGGCAGCCAGAGCCAAAAGGG - Intergenic
913971938 1:143422869-143422891 TCTGGAAGCCTCAGCCATGAAGG - Intergenic
914066317 1:144248482-144248504 TCTGGAAGCCTCAGCCATGAAGG - Intergenic
914112836 1:144717872-144717894 TCTGGAAGCCTCAGCCATGAAGG + Intergenic
914901167 1:151711880-151711902 CCTGGGAGCCTATGCCAGGAGGG - Intronic
915525753 1:156475323-156475345 CCTGAATCCCAAAGCCAAGGCGG + Intronic
916119831 1:161519232-161519254 CCTGAAAGCCACAGACAATATGG + Exonic
916139088 1:161677712-161677734 CCTGAAAGCCACAGACAATATGG + Exonic
916368249 1:164058584-164058606 CATGGAAGCTGAAGCCAAGGTGG + Intergenic
916945240 1:169719703-169719725 TCTGGAAGGTAAAGGCAAGATGG - Intronic
917314764 1:173713318-173713340 ACTGAAAGCTAAAGGCAAGATGG - Intergenic
917643153 1:177003152-177003174 CCTTGATGCCAAAGCCAGGAAGG + Intronic
917903198 1:179564222-179564244 TCTGGAAGCACATGCCAAGATGG - Intronic
918526080 1:185466524-185466546 CCTGGAAGGCAAGGCCAGAATGG + Intergenic
920374327 1:205499270-205499292 CCTGGAAGCTAAAGGCCAGTGGG + Intergenic
921226962 1:213030183-213030205 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
921287257 1:213620444-213620466 CTTGGAGCCCTAAGCCAAGAAGG - Intergenic
921682195 1:218047286-218047308 CCTAGAAGCCAAGGCAAAAAAGG - Intergenic
924582255 1:245332633-245332655 CCTGGAAGCCACAGCCCTGCTGG + Intronic
924608304 1:245553719-245553741 ACTGAGAGCCAAAGCCAAGGCGG + Intronic
924788078 1:247219002-247219024 CCTGGGAGCCAAAGGAAAGAGGG + Intergenic
924804958 1:247354680-247354702 CCTGGGAGCCAAAGGAAAGAGGG + Intergenic
1067059334 10:43069885-43069907 CCTGGAAGCCAGGGCCCAGAGGG + Intergenic
1067286867 10:44913238-44913260 TTTGGAAACCAAAGCCTAGAGGG - Intronic
1067685038 10:48461613-48461635 CCTGGCAGCCCAGGCAAAGAAGG + Intronic
1070322990 10:75368509-75368531 CCTGGAGGCCAAAGCAAAGAAGG + Intergenic
1071328282 10:84537814-84537836 CCTGGCAGCCAAGGCTAAGAAGG + Intergenic
1073349464 10:102809618-102809640 CCTGTAATCCCAGGCCAAGATGG - Intronic
1074209131 10:111312434-111312456 CCTGGCAGCCAAAGCAAAAAGGG - Intergenic
1074459381 10:113623543-113623565 CCTGGCAGCCAAAGCCAAGAGGG - Exonic
1075002676 10:118809724-118809746 GCTGGGTGCCAAAGCCAAGATGG + Intergenic
1075443416 10:122497208-122497230 CCTGGTAGATAAAGCAAAGAAGG - Intronic
1075722512 10:124595560-124595582 CCTGGCAGCCAAAGCAAAGAGGG - Intronic
1075902623 10:126055227-126055249 TCTGGAAGCCCAGGCCAGGAGGG - Intronic
1076445555 10:130511569-130511591 CCTGAAAGCCAGAGCAAGGAGGG - Intergenic
1077744701 11:4889756-4889778 CATGGATGCCAAAGCAATGACGG + Intronic
1077983957 11:7332040-7332062 CCTGGAAGCAGAAGCTGAGAGGG + Intronic
1078409906 11:11106003-11106025 CTTGGAAGTTAAAGGCAAGATGG - Intergenic
1078557330 11:12340051-12340073 TCTGGAAGGTAGAGCCAAGATGG - Intronic
1078723010 11:13901353-13901375 CCTGACAGCCAAAGAAAAGATGG - Intergenic
1078843410 11:15100299-15100321 CCTGAAATCCAAACCGAAGAAGG - Intergenic
1081100427 11:38995083-38995105 CCTGGAAGCCACACTCATGAAGG - Intergenic
1081705028 11:45177765-45177787 CCTGGCAGCCAAAGCATAAAGGG - Intronic
1082580092 11:54855646-54855668 CCTGGCAGCCAAGGCAGAGAAGG - Intergenic
1082883160 11:58058222-58058244 CCTGGCAGCCAAAGCCCTGTGGG - Intronic
1083487725 11:62993957-62993979 CTTGGAAGCCAAAGCAAAAAGGG - Intronic
1084801904 11:71549477-71549499 CCTGGCAGGCAAAGGAAAGAAGG - Exonic
1084937421 11:72594596-72594618 CCTGGCAGCCAGAGCCCAGCTGG + Intronic
1085206123 11:74732932-74732954 CCTGGAAGCAAAGGCAAAAAGGG - Intergenic
1086942857 11:92816345-92816367 CTTGGAAGCCAAAGGTCAGAAGG - Intronic
1086971627 11:93086874-93086896 CCTGGAAGCCCAGGCAAAAAGGG - Intergenic
1087813981 11:102638396-102638418 CCTGGAAGCCAACTCTGAGAGGG + Intergenic
1091237957 11:134034250-134034272 CCAGGAAGCCGTGGCCAAGAGGG - Intergenic
1092258872 12:6941859-6941881 CCTGCCACCCAGAGCCAAGAGGG + Exonic
1092909008 12:13128661-13128683 ACTGCAAGCCAAAGGAAAGAGGG - Intronic
1095899190 12:47310028-47310050 ACTGGAAGCCAAAACAAAGCAGG + Intergenic
1096342462 12:50812980-50813002 CCTGGTAGCCAAAGCATAAAAGG + Intronic
1096396250 12:51269156-51269178 CCTGGAAGCCTCAGCCCAGGTGG - Intronic
1096636780 12:52965351-52965373 CCTTAAAGCCACTGCCAAGACGG + Intergenic
1098294543 12:68991039-68991061 CCTGGTAGACTGAGCCAAGATGG + Intergenic
1098572391 12:72003088-72003110 CCAGGTAGGCAAAGACAAGAGGG - Intronic
1098649954 12:72952422-72952444 CCTGGAAGCCTAAGGAAAAATGG - Intergenic
1100190762 12:92188984-92189006 CCTAGAAGCCAAGGCAAGGAGGG - Intergenic
1101042402 12:100770113-100770135 CCTGGTAGCCAAAGCAAAAAGGG - Intronic
1101532781 12:105589685-105589707 CCTGGAAACCAAGGAAAAGAAGG + Intergenic
1101752170 12:107590799-107590821 CCAGGAAGCCAAATCCCACATGG - Intronic
1102843346 12:116150360-116150382 CTTGGAAAGCAAATCCAAGAAGG + Intronic
1103031932 12:117622526-117622548 CCTGGAAGACAAGGTCAAGCAGG + Intronic
1103666708 12:122573120-122573142 CCTGGATGCCAAAAGAAAGATGG - Exonic
1103745252 12:123118498-123118520 CCTGGTAGGCAAAGCAAAGAGGG + Intronic
1103952720 12:124559804-124559826 CCTAGTAGCCAAAGCAAAGAGGG + Intronic
1104041000 12:125130710-125130732 CCTGGCAGCCAAGGCAAAAATGG - Intronic
1105602753 13:21901820-21901842 TCTGAAAGGCACAGCCAAGAGGG - Intergenic
1105645120 13:22309739-22309761 CCTGGTAGCAAAAGCAAAGAGGG - Intergenic
1105828680 13:24144840-24144862 ACTGGAAGACAAAGGCAAGGAGG - Intronic
1106160754 13:27199370-27199392 CCTGGAGTCCAAAGGCCAGAGGG - Intergenic
1106186992 13:27418344-27418366 TGTGGAAGCCAAAGCCAAGAAGG + Intergenic
1106307456 13:28526031-28526053 ACTGAAAACCAAAGCCAAGAGGG + Intergenic
1107038735 13:35927061-35927083 TGAGGAAGCCAAAGCCCAGAGGG - Intronic
1107564302 13:41586299-41586321 CCTGGCAACTAAAACCAAGAGGG + Intronic
1108140511 13:47416108-47416130 CCTGGAGGACAGAGCCAGGAGGG + Intergenic
1108272161 13:48771946-48771968 TCTGGAAGCCTAGGCCCAGATGG + Intergenic
1108526038 13:51286834-51286856 CCTGGAAGCCAGAGCGAAAAGGG + Intergenic
1108531324 13:51329998-51330020 AGTGGCAGCCAAAGCCAAGGGGG + Intergenic
1108635990 13:52334505-52334527 ACTGGAAGCCAGAGCCTAAATGG - Intergenic
1108651820 13:52488743-52488765 ACTGGAAGCCAGAGCCTAAATGG + Intergenic
1109041555 13:57345387-57345409 CTTGGAAGTTAAAGACAAGATGG - Intergenic
1109848598 13:68031335-68031357 CTTGTAAGACAAAACCAAGAAGG + Intergenic
1111256580 13:85677405-85677427 CTTGGAAGCTAAAAGCAAGATGG + Intergenic
1111918665 13:94387925-94387947 CATAGAAGCCCAAGCTAAGACGG + Intronic
1112387293 13:98951750-98951772 CCATGAAGCCAAAGCACAGATGG + Intronic
1113020613 13:105882058-105882080 CCTGAAAACTAAAGCCAAGATGG + Intergenic
1113714748 13:112495083-112495105 ACTGGCAGCCAAAGCAAAAATGG - Intronic
1114452992 14:22838503-22838525 CCTGGACCCCTAAGCCAAGGTGG + Intronic
1115300751 14:31882584-31882606 CCAGAAAGTCAAAACCAAGAAGG - Intergenic
1115378116 14:32701350-32701372 CCTGGTAGTGAAAGCAAAGAGGG + Intronic
1118041982 14:61927175-61927197 CCTGGAATTTAAAACCAAGAGGG - Intergenic
1118324746 14:64773424-64773446 CCTGGAATTCAAAACCAAAAAGG + Exonic
1119397043 14:74334181-74334203 CCTGGAAGCCAAAGCCAAGAAGG + Intronic
1119559335 14:75578179-75578201 GCTGGGAGCCTAAGCCAAGGGGG + Intergenic
1120623398 14:86793145-86793167 CTTCAAAGCCAAAGTCAAGAAGG + Intergenic
1121269308 14:92627341-92627363 CCTGCATGCCAATGCTAAGAGGG - Intronic
1121283215 14:92714441-92714463 CCTGGGGGCCACTGCCAAGAAGG + Exonic
1121502431 14:94448746-94448768 CCCAGTAGCCAAAGCCAAGCTGG + Exonic
1121929631 14:97960625-97960647 CCTGGCAGCCCAAGCGCAGAAGG - Intronic
1122062543 14:99146180-99146202 CCTCGCTGCCAAAGCAAAGAGGG - Intergenic
1122371527 14:101231492-101231514 CCTGGAAGCCAAAATGAAAAGGG - Intergenic
1122504700 14:102224971-102224993 ACAGGAAGCCAAACCCAGGAGGG + Intronic
1122972354 14:105157561-105157583 CCTGGCAGCCAAAGCAAAAAGGG + Intronic
1124246906 15:28078959-28078981 CCTGGGAGCCAAAGGAAAAAGGG + Intronic
1126670096 15:51108346-51108368 CAGAGAAGCCAAAGCAAAGAGGG - Intergenic
1128303277 15:66580826-66580848 CCAGGCAGCCAAAGCCCAGGGGG - Intergenic
1128512290 15:68320692-68320714 CCTAGCAGCCAAGGCCAAAAGGG - Intronic
1128694343 15:69749153-69749175 CTTGGAAGCCAAAGCAAAAGGGG - Intergenic
1128943451 15:71806678-71806700 AATGGAAGCCAAAGCCCAGCAGG - Intronic
1129693973 15:77730118-77730140 ACTAGATGCCAGAGCCAAGAGGG - Intronic
1129824941 15:78628726-78628748 CCCAGAAGCAAACGCCAAGATGG - Intronic
1130093809 15:80841393-80841415 CCTGGAGTCCACAGGCAAGAAGG + Intronic
1130649542 15:85754464-85754486 CCTGGCAGCCACAGCTAAAAGGG + Intergenic
1130663075 15:85845989-85846011 ACAGGAAACCAAAGCAAAGATGG + Intergenic
1131079783 15:89525146-89525168 CCTGGCAGCCAAGACCAAAAGGG - Intergenic
1131180100 15:90233703-90233725 CCTGGAAGGCAAAGCCAGAGCGG + Exonic
1131373613 15:91905113-91905135 CCTGGGAACCAAAGCAAACAGGG + Intronic
1131567691 15:93501808-93501830 CCTGGATGCCAAGGGGAAGACGG - Intergenic
1131802458 15:96085251-96085273 CCTGTAATCCCAGGCCAAGACGG + Intergenic
1131988200 15:98066122-98066144 GCTGGGAGCCACAGCCCAGAGGG + Intergenic
1132153697 15:99480245-99480267 CCTGGAAGTCAAAACTAAAATGG + Intergenic
1132515414 16:363695-363717 CGGGGAAGCCAAGGCCAGGAAGG - Intergenic
1133062372 16:3183231-3183253 CAGGGAAGCCAAAACCCAGAAGG + Intergenic
1133468014 16:6046674-6046696 CTGAGAATCCAAAGCCAAGATGG - Intronic
1133707758 16:8371497-8371519 CCTGGCAGCCAAAGCAAAGAGGG + Intergenic
1134019052 16:10908807-10908829 CCTGGTAGCCGAAGCAAAAAGGG + Intronic
1134829934 16:17314777-17314799 CCTGGTGGCCAAAGCAAAAAGGG + Intronic
1136372921 16:29847431-29847453 CCAGGAAGGCAGAGCCAAGGCGG + Intronic
1138083253 16:54111897-54111919 TCTGGAAGCAAAACCCTAGAAGG + Exonic
1138807242 16:60105061-60105083 CCTGGTAGCCAGTGCAAAGAAGG + Intergenic
1138844233 16:60545744-60545766 TTTGGAGGTCAAAGCCAAGATGG + Intergenic
1140227868 16:73093230-73093252 CCTGGAAGTCAACGCCAGGTAGG - Intergenic
1140800932 16:78487816-78487838 CCTGGAAGCCAGAGAAAAGGAGG - Intronic
1142045271 16:87921382-87921404 ACGGGAGGGCAAAGCCAAGAGGG - Intronic
1142330836 16:89452332-89452354 CCTGGAGCCACAAGCCAAGAGGG + Intronic
1142389973 16:89792879-89792901 CCTGGAAGCCGAGGCAGAGAGGG + Intronic
1142846931 17:2685921-2685943 CCAGAGAGCCAAAGCCAGGATGG + Intergenic
1144025471 17:11272883-11272905 CCTGGAATCCAGATCCAAGGTGG + Intronic
1147919065 17:43905558-43905580 CCAGGAAGGCAAAGGGAAGAAGG - Intronic
1147988003 17:44317463-44317485 CCTGGCAGCCAAAGAGAAGGGGG - Intronic
1148241950 17:46005254-46005276 CCTGGAAGCCGAGGCAAAAAGGG - Intronic
1150523675 17:65897977-65897999 CCTGGAAGCCACAGCAAAGAGGG - Intronic
1151185630 17:72361950-72361972 CCAGGAAGCCAATGCAGAGATGG - Intergenic
1151215159 17:72572062-72572084 CCGGGGGGGCAAAGCCAAGATGG - Intergenic
1151241068 17:72758268-72758290 TCTGGAAGACACAGTCAAGAAGG + Intronic
1151320312 17:73348846-73348868 CCTGGAAGGCAGACCCAGGAAGG - Intronic
1151326855 17:73385032-73385054 CCTTGAAGACAAAGCCAGGAGGG - Intronic
1151334977 17:73434416-73434438 CTTGGAAGCCAGAAGCAAGACGG + Intronic
1151741313 17:75984153-75984175 CTTAGAGGCCAAAGGCAAGAGGG + Intronic
1151891916 17:76956170-76956192 CTTGGAGGGCAAAGCCATGAGGG - Intergenic
1152653375 17:81507285-81507307 CCTGGATGACAGAGCCAGGATGG + Intergenic
1155016932 18:21852468-21852490 ACAGGAAGCCAGAGCCAAGGTGG + Intronic
1155178845 18:23325474-23325496 CCTGGCAGCCAAAGCAAAGAAGG + Intronic
1155561322 18:27080398-27080420 CCTGGATGCCCAAGCAGAGACGG + Intronic
1157877931 18:51290868-51290890 TCTGGAAGCCACAGTCATGATGG - Intergenic
1158401647 18:57126819-57126841 ACTGGAAGCCCAACCCAAGGTGG - Intergenic
1160033780 18:75283237-75283259 CCTTGTAGCCCAAGCCAACATGG + Intronic
1160147481 18:76376947-76376969 CTTGGAACCCAAAGCAGAGAAGG - Intronic
1160423233 18:78763340-78763362 CCAGGAAGCCAAAGCTAAAATGG + Intergenic
1160691184 19:461219-461241 CCTGGAACCCGCAGCCAAGGCGG + Intergenic
1161205726 19:3040268-3040290 CCTGGAAGGCACAGCACAGATGG + Intronic
1161208550 19:3054781-3054803 CCTGGTAGCCAAGGCAAAAAGGG - Intronic
1161516789 19:4700884-4700906 CCTGGAGGCCAGAGCCACGAGGG - Intronic
1162494873 19:11018056-11018078 GCTGGAAGCCACAGCCAACCAGG - Intronic
1162613157 19:11772098-11772120 CCTGGCAGCCAAGGCAGAGAGGG - Intronic
1163636949 19:18441397-18441419 CCTGCCAGCCAAGGACAAGAAGG - Intergenic
1164667592 19:30051762-30051784 CCTGGAAGACAGAGGCAAGGGGG + Intergenic
1165124713 19:33585824-33585846 CCTGGAGCCCTAAGCCAGGAGGG + Intergenic
1165608346 19:37127258-37127280 TTTGGAAGCCAAAGGCAAGATGG + Exonic
1166394151 19:42426555-42426577 CCAGGGAGCCAAATCCAAGCAGG - Exonic
1167565649 19:50254894-50254916 CCTGGCAGCCAGAGCAAAAAGGG + Intronic
925013856 2:506937-506959 CCTGGAAGCCCAAGGCAGTAGGG + Intergenic
925014076 2:508538-508560 CCTGGAAGCCAAAGGGCAAAAGG + Intergenic
925490679 2:4389722-4389744 CATGGTAGCCAAAGTGAAGAGGG + Intergenic
925608277 2:5681594-5681616 CCTGAGACCCAAAGCCAAAAGGG + Intergenic
925843837 2:8018165-8018187 CCTGGCAACCAAAGCAAAAAGGG - Intergenic
928030019 2:27770116-27770138 TCTGGTAGCCAAAGACAATAGGG + Intergenic
928241574 2:29591387-29591409 CCGGGCAGCCACAGCCAGGATGG + Intronic
928409036 2:31039978-31040000 CCTGGTAGCCAAAGTGAAAAGGG - Intronic
928715387 2:34055045-34055067 CCTGGAAATCATACCCAAGAAGG - Intergenic
930721685 2:54644301-54644323 CCTGGAAAACAAAACCAACATGG - Exonic
932380581 2:71278035-71278057 CCTAGAAACCAGAGCCAAGAAGG - Intronic
934286939 2:91658162-91658184 TCTGGAAGCCTCAGCCATGAAGG - Intergenic
937256687 2:120560858-120560880 TCTGGAAGGCAAAGGCTAGAGGG + Intergenic
937542081 2:122968688-122968710 CCTGGGAGCCACAGAAAAGAAGG - Intergenic
937601041 2:123732677-123732699 CCTGGAAGCCAATGCTAGAAAGG + Intergenic
937875331 2:126820912-126820934 ACTGGAAGCAGAAGGCAAGAGGG + Intergenic
938845954 2:135209367-135209389 CCTTGAAGGGAAGGCCAAGAGGG - Intronic
938947530 2:136226656-136226678 CCTGGAAGACAAAGCACAGAAGG + Intergenic
940098546 2:150006733-150006755 CCTGGGAGCCAAATTGAAGAAGG - Intergenic
940239194 2:151544815-151544837 CCTGGAAGCCAATGCTCAGCTGG + Intronic
940352092 2:152702145-152702167 CCGGCATGCCAATGCCAAGAGGG + Intronic
940779802 2:157920590-157920612 CCAGGAGGCCAAAGCAAAAAGGG + Intronic
943013180 2:182476920-182476942 CCTGGCAGCCAAAGTAAACAGGG + Intronic
943291380 2:186076692-186076714 GCTAGAAGCCAAAGGCAAGGAGG - Intergenic
943726046 2:191252843-191252865 TCTAGAATCCAAAGTCAAGATGG - Intronic
943732328 2:191315547-191315569 CCTGGTAGTCAAAGCAAAAAAGG + Intronic
943831444 2:192468139-192468161 CTTGGAAGGCTAAGGCAAGAGGG - Intergenic
944303102 2:198146911-198146933 CCTGGAAGCCATAGAGGAGAAGG + Exonic
945779578 2:214152810-214152832 CCTGGCAGCCAAGGCAGAGAGGG + Intronic
946021683 2:216644449-216644471 CCAGGAAGTCAAAGGGAAGAGGG + Intronic
946056297 2:216905093-216905115 ACTGGAAGCAGAAGCCCAGAAGG - Intergenic
946408788 2:219506414-219506436 CCAGGAAGCCATACCCAGGATGG - Exonic
946753568 2:222919180-222919202 CCTGGGAGCCAAGGCCAGCATGG + Exonic
947344381 2:229175672-229175694 CCTGGAAGACAATACAAAGAGGG + Intronic
947346974 2:229201876-229201898 CATGGAAGCCAAAGTGAATATGG - Intronic
948295390 2:236856649-236856671 CATGGAAGCCTGAGCCACGATGG - Intergenic
948417389 2:237821232-237821254 CCTGGAAGCAAAAGTAGAGAAGG - Exonic
948641904 2:239380098-239380120 CATGGGTGCCAGAGCCAAGAGGG + Intronic
949058124 2:241940379-241940401 CCAGGATGCCGAAGCAAAGAGGG - Intergenic
1170537517 20:17356012-17356034 CTAGGAAGCCATTGCCAAGATGG - Intronic
1170546455 20:17439055-17439077 CCTGGCAGCCAAAGGAAAAAGGG - Intronic
1170618274 20:17972163-17972185 ACTGGATCCCAAACCCAAGAAGG + Intronic
1171027077 20:21640590-21640612 GCAGGAAGACAGAGCCAAGATGG + Intergenic
1172601527 20:36187161-36187183 CCTGGCAGCCAAAGCAAAGAAGG + Intronic
1173583911 20:44167251-44167273 CTTGGAAGGCAAAGACAAGCAGG - Intronic
1173782834 20:45770919-45770941 CCTGGTAGCCAATGCGAAGATGG + Intronic
1173969816 20:47143896-47143918 CCTGGTAGCCAAAGTAAAGAGGG + Intronic
1174085886 20:48006879-48006901 CCTGGAGGTCAAAGGCAGGAGGG - Intergenic
1174851633 20:54001235-54001257 CTTGGAAGTTAAAGGCAAGATGG - Intronic
1175172763 20:57091808-57091830 CCAGGCAGCCAAAGCAGAGAGGG + Intergenic
1175941074 20:62537770-62537792 ACTGGAAGCCACAGCCCAGGTGG - Intergenic
1175942332 20:62543243-62543265 CCTGGAAGACATAGCACAGATGG - Intergenic
1176420303 21:6508668-6508690 CCTGGCAGCCAAGGCAGAGAGGG + Intergenic
1177989808 21:28023457-28023479 CTTTGAAGACAAAGGCAAGAAGG - Intergenic
1178194637 21:30329641-30329663 TCTAGAAGCCACAGCAAAGAAGG - Intergenic
1179112438 21:38458975-38458997 TATGGAAGCCAAAGAAAAGAGGG - Intronic
1180675357 22:17582541-17582563 CCTGGAAGTGAAGGACAAGATGG - Exonic
1181324386 22:22033487-22033509 CCTGGAAACCAAATCCATAATGG + Intergenic
1181868913 22:25882298-25882320 CCTAGCAGCGAAAGCTAAGAGGG + Intronic
1181964286 22:26645737-26645759 CCTGGAAGACAATGCAAAGAGGG - Intergenic
1182653015 22:31867367-31867389 CCTGGTAGCCAAAGAAAAGTGGG + Intronic
1182737046 22:32538170-32538192 CCTAACAGCCAAAGCAAAGAAGG - Intronic
1183239215 22:36643697-36643719 CCTGACAGCCAAAGCAGAGAGGG + Intronic
1183885378 22:40876313-40876335 CCGGGAATCCAAAGCCAGGCAGG - Intronic
1184282344 22:43445041-43445063 CCTGGGGGCCAAAGTGAAGAAGG + Intronic
949344861 3:3067475-3067497 CCTGGAAGCCGCAGTCTAGAGGG + Intronic
949672415 3:6414827-6414849 CCTGGAAGCCTAGGCTCAGATGG - Intergenic
950161202 3:10762653-10762675 ACTGGAAGCCAATGTCAAGTTGG + Intergenic
950250289 3:11459582-11459604 CCTGGAAGCCAGAGCCAACAGGG + Intronic
950532740 3:13562160-13562182 CCTGGCAGCCAAAGCCAAAAGGG - Intronic
951588875 3:24242213-24242235 TCAGGAAGCCAAAAACAAGATGG + Intronic
952319439 3:32262249-32262271 GCTGGCAGACATAGCCAAGAAGG - Intronic
952563322 3:34622483-34622505 CCTGTAAGCCAAAGCTAGCAAGG - Intergenic
953682213 3:45048206-45048228 CCTAGAAGCGGAGGCCAAGAAGG - Intergenic
953711042 3:45271197-45271219 CTTGGCAGCCAAAGAAAAGAAGG - Intergenic
953736239 3:45496422-45496444 CCTAGAAGCAAAGACCAAGATGG + Intronic
953878113 3:46677830-46677852 CCTGGCAGCCAAGGTAAAGAAGG - Intronic
954258505 3:49422402-49422424 CCTGCAGGCGAAAGCCCAGACGG + Exonic
955095560 3:55794311-55794333 CCTGGCAGCCAGAGCAAAAAGGG - Intronic
955344491 3:58150987-58151009 CCTGTTAACTAAAGCCAAGAAGG - Intronic
955391062 3:58522601-58522623 CCTGAAAGCCAAAGCAAAAAAGG + Exonic
955474161 3:59318569-59318591 CCTGACAACCAAAGCCAAAAGGG - Intergenic
957530450 3:81434241-81434263 CCATGAAGCAAAAGCAAAGAAGG + Intergenic
958550843 3:95609813-95609835 CCTGAAGGCTAAAGGCAAGATGG - Intergenic
963298280 3:143571675-143571697 TCTGGCAGTCAAAGCCAAAAGGG - Intronic
963443849 3:145375579-145375601 CCTGGAAGGCCATCCCAAGAAGG + Intergenic
963590692 3:147254349-147254371 CCTGGAAGTCAGAGTCAGGAGGG - Intergenic
964737296 3:159929905-159929927 TCTGGAAGCCAAAATAAAGAAGG + Intergenic
965974212 3:174601665-174601687 ACAGGAAACCAAAGCCAAAATGG - Intronic
966370602 3:179247600-179247622 CCTAGCAGCCAAAGCAATGAAGG + Intronic
967250405 3:187531826-187531848 CCTGGAAGCAAAAGAGAACATGG + Intergenic
967259740 3:187630452-187630474 CCTAGAAGCCAAATCTCAGATGG + Intergenic
967687165 3:192431064-192431086 CCTGTAAGCCAAAGGAATGAAGG + Intronic
967949338 3:194828836-194828858 CCTGGAAGCAAGAGCAAACACGG + Intergenic
968300923 3:197613883-197613905 CTTGAAAGCTAAAGGCAAGAGGG + Intergenic
969393897 4:6908774-6908796 CATGGAACCCACAGCCTAGAAGG + Intergenic
970234857 4:13948273-13948295 CCTGGTAGCCAAAGCAAAAAAGG + Intergenic
971512615 4:27445917-27445939 TCTGGAAGACAAAGCCAGGGCGG + Intergenic
971706690 4:30052997-30053019 CATGGTAGCCAAAGTAAAGAGGG + Intergenic
972538655 4:40020401-40020423 CCTGGAACCCAATGCCGAGCCGG - Intergenic
973861409 4:55068873-55068895 CCAGCAGGCCAAAGCCAAGGGGG + Intergenic
975751332 4:77526830-77526852 GCTGAGACCCAAAGCCAAGAAGG + Intronic
975859796 4:78664460-78664482 CCTTGAAGCCGAAGCAGAGAGGG - Intergenic
977774153 4:100897446-100897468 CCAGGAAGCCCAATACAAGATGG + Intergenic
980166819 4:129239216-129239238 CAGGAAGGCCAAAGCCAAGAAGG - Intergenic
981227297 4:142312391-142312413 CCTCAAAGCTGAAGCCAAGAGGG + Intronic
983751264 4:171274915-171274937 TTTGGAACCCAAAACCAAGAGGG - Intergenic
984902747 4:184599664-184599686 CCTGGAGGTCAGAGGCAAGATGG - Intergenic
984956301 4:185049421-185049443 CCTGGAAAGCAGAGCCAGGAGGG - Intergenic
986045207 5:4030211-4030233 GCTGGAAGCCAGTGGCAAGAAGG - Intergenic
986131047 5:4930515-4930537 CCTGGCAGCCCCAGCAAAGAAGG + Intergenic
986212336 5:5685877-5685899 CTTGAAAGCTAAAGGCAAGAAGG - Intergenic
987387962 5:17348068-17348090 CATTGAAGCCAAAGTCAAAAGGG - Intergenic
989673042 5:43942029-43942051 ACAGGAAACCAAAGCCAAAATGG + Intergenic
990558086 5:56955058-56955080 TCTGGCAGCCAAAGCAAAAAAGG + Intronic
990780148 5:59351617-59351639 CCATGAAGCAAAAGCCAGGAGGG + Intronic
991593862 5:68282466-68282488 CATGGAAGCCAAAGCCAGACAGG + Intronic
992058919 5:73022419-73022441 CCAGGAAGCCAAAGCAGAGTGGG - Intronic
993487697 5:88506690-88506712 CCTCAAAGCCAAAGCCTAAAGGG - Intergenic
993508087 5:88736162-88736184 GATGGAAGCCAAAGCTAAGATGG - Intronic
995090679 5:108172278-108172300 TCTTGAAGCCAAAGCTCAGAAGG + Intronic
995858154 5:116615200-116615222 CCTGGGAGCCACAGCCAACCAGG - Intergenic
997956567 5:138283213-138283235 CCTTGAACTCAAAGCCCAGAAGG - Intergenic
998005281 5:138652642-138652664 CCAGGAACTCAAAGCCTAGATGG - Intronic
998539306 5:142965051-142965073 CCTGGCAGCCAAGGCAGAGAGGG + Intronic
998650148 5:144109912-144109934 CATAGAACCCAAAGACAAGAGGG + Intergenic
999175969 5:149632056-149632078 CCTGGAGGCCCAGGACAAGAAGG + Exonic
999666993 5:153922879-153922901 CCAAGAAGCAAAAGCCAAGATGG - Intergenic
1000313451 5:160066544-160066566 CCTGTAATCCAAAGCCAAGGTGG - Intronic
1001551491 5:172605390-172605412 CCCAGCAGCCAAAGCAAAGAAGG + Intergenic
1001661775 5:173398682-173398704 ACTGGTGGCCAAAGCAAAGAGGG + Intergenic
1001855166 5:175004461-175004483 CCTGGCAGCCAAGGAGAAGAGGG + Intergenic
1002441837 5:179268383-179268405 CCTGGCAGGCAATGCCAACAAGG - Intronic
1003015225 6:2462604-2462626 CATGGATGCCGAAGCGAAGAGGG - Intergenic
1003021111 6:2510424-2510446 CCTGGTAGCCAAAGCCATATGGG - Intergenic
1003208160 6:4033834-4033856 CCAGGAAGCCAAAGGAAAAAGGG - Intronic
1003487664 6:6593650-6593672 CCTTGAAGCCAAATCAAACAAGG + Intronic
1004559904 6:16739480-16739502 CCTGTGAGCTAATGCCAAGATGG + Intronic
1004868615 6:19879713-19879735 CCTGTAAGTCAAAGCAAACATGG + Intergenic
1005621048 6:27620668-27620690 CTTGGAGGCAAAGGCCAAGATGG - Intergenic
1005967810 6:30740292-30740314 ACAGGAAGCTAAAGCCAAGCAGG - Exonic
1010651368 6:78459094-78459116 CTTGTAATCCAAAGCCAAGTTGG - Intergenic
1011328302 6:86174927-86174949 CCTGGCAGCCAAGGCAGAGAGGG + Intergenic
1011560136 6:88605811-88605833 CCTGGAAGCCAACTGCAAAAGGG + Intergenic
1012217301 6:96603016-96603038 GGTGGAAGCCACAGCCAAGGAGG + Intronic
1013629147 6:111968310-111968332 CCTAGCAGCCAAAGGAAAGATGG + Intergenic
1019361546 7:607352-607374 CCTCGGAGCCAAAGTCCAGAGGG - Intronic
1019666448 7:2254382-2254404 CCTGGAAGACAAAGGCGTGACGG - Exonic
1019747447 7:2708791-2708813 GCTTGAAGCAAAAGCAAAGAGGG - Intronic
1020138475 7:5599300-5599322 CCAGGAACCCATAGACAAGAGGG + Intronic
1021432583 7:20577715-20577737 CCTGGAAGCCAAAACAGAAAGGG - Intergenic
1021759225 7:23887078-23887100 CCTGGAAACAGATGCCAAGAAGG - Intergenic
1021970789 7:25963882-25963904 GCAGGAAACCAAAGCCAAGAAGG + Intergenic
1021972042 7:25974825-25974847 CCTAGAAGCAAAAGCAAAAAGGG + Intergenic
1022551178 7:31240508-31240530 CCTGGGAGCCAAAGCAAAAAGGG + Intergenic
1022890554 7:34693123-34693145 AATGGAAGGCAAAGCGAAGAGGG - Intronic
1023035903 7:36131207-36131229 ACTGGATGCCAATGCCATGAGGG - Intergenic
1024087984 7:45912573-45912595 CCCGGAGGCCAAACCCAAGAAGG - Intronic
1025104687 7:56161373-56161395 CCAGGAATGCAAAGCCAAAAGGG + Intergenic
1026833612 7:73624160-73624182 CCTGGAAGCCAAGGCCGTCAGGG + Intronic
1027179071 7:75925142-75925164 CCTAGATGCCAAGGCAAAGAAGG + Intronic
1028660723 7:93269884-93269906 CCTAGCAGCCAAAGCAAATAGGG - Intronic
1029207890 7:98879694-98879716 CCGGGTAGGAAAAGCCAAGAAGG - Intronic
1029214431 7:98936342-98936364 AGTGCAAGCCAAAGCCAACAGGG + Intronic
1029622285 7:101697766-101697788 CCTAGTAGGCAAAGCAAAGAGGG + Intergenic
1029945914 7:104532657-104532679 TCTGGAAACAAAAGCCAAGAAGG + Intronic
1030727053 7:112939068-112939090 CCTGGAAGCCAATGCGAGGAAGG + Intronic
1030983245 7:116210713-116210735 CCTGGAAAACAAAGTGAAGAAGG + Exonic
1031586389 7:123535470-123535492 CCTGGCAGCCAAAGAGAAAAGGG + Intergenic
1032098093 7:128949564-128949586 CCTGGAAGGCAAAGCCAGCCAGG - Intronic
1032435693 7:131898561-131898583 CCTGAAAGAGAAAGCCCAGAAGG - Intergenic
1033406692 7:141076194-141076216 CTTGGCAGCCAAACCCAAGTTGG - Intronic
1033604892 7:142919746-142919768 CCTGGAAGGAAATGCCCAGAAGG + Intronic
1035179210 7:157077175-157077197 ACTGGAAGCCACGGCCAAGGTGG - Intergenic
1035546578 8:486389-486411 CCCAGTAGCCACAGCCAAGAAGG - Intergenic
1037536288 8:19827604-19827626 CCTGGACACCAAACCCAGGAGGG - Intronic
1037561123 8:20075198-20075220 TCTGGAAGTTAAAGGCAAGATGG + Intergenic
1037616148 8:20520498-20520520 CCTGGAAGGCAATACCAGGAAGG - Intergenic
1038339151 8:26669641-26669663 CTTGAAGGCCAAAGGCAAGAGGG + Intergenic
1038398704 8:27266739-27266761 CTTGAAGGCCAAAGGCAAGATGG - Intergenic
1038676044 8:29623901-29623923 CCTGCAGGCCAAAGCTAAGGTGG + Intergenic
1039406779 8:37319610-37319632 CTTGGAAGTTAAAGGCAAGATGG + Intergenic
1041113633 8:54512014-54512036 CCTGGAGGCAGGAGCCAAGACGG - Intergenic
1042638001 8:70900266-70900288 CCTGGCAGCCAATGCAAAAATGG + Intergenic
1042824662 8:72967893-72967915 TTTGGAAGGCAAAGCCAGGAGGG + Intergenic
1043457221 8:80424706-80424728 GCTGGAAAGCAAAGCCTAGAAGG - Intergenic
1043627413 8:82279337-82279359 ACAGGAAACCAAAGCCAAAATGG + Intergenic
1044961819 8:97538718-97538740 CCTAGAAGCCAAAGAGAAGCAGG + Intergenic
1046067508 8:109214103-109214125 CCTGGCAGCCAAGGCAGAGAGGG - Intergenic
1047541211 8:125768440-125768462 CCTGGAAGAGGAAGGCAAGAAGG + Intergenic
1047748568 8:127863731-127863753 CTTGGAAGCCAAAGCCCAGAGGG + Intergenic
1048278719 8:133088953-133088975 TCTGGAAGCTAAAGCACAGATGG - Intronic
1051563065 9:18464915-18464937 CCTAGTAGCCAAAGAAAAGATGG + Intergenic
1051719771 9:20024434-20024456 GCTGAAGGCCAAAGCCAGGAAGG - Intergenic
1052644785 9:31219743-31219765 CATGGGACACAAAGCCAAGAAGG + Intergenic
1053079096 9:35159854-35159876 TCTGGCACCCAAAGCCAAAAAGG + Intergenic
1053457789 9:38244316-38244338 CCCAGAAGCCAAAAACAAGAGGG + Intergenic
1053552311 9:39096809-39096831 TTTGAAAGCCAAAGTCAAGAAGG - Intronic
1053816438 9:41916969-41916991 TTTGAAAGCCAAAGTCAAGAAGG - Intronic
1054106698 9:61060651-61060673 TTTGAAAGCCAAAGTCAAGAAGG - Intergenic
1054614159 9:67270474-67270496 TTTGAAAGCCAAAGTCAAGAAGG + Intergenic
1054935294 9:70680969-70680991 CCTGGAAGTCAAGGCAAAAATGG - Intronic
1055150546 9:72993670-72993692 TCTGGAAGCCAAAGTAAAAAAGG + Intronic
1055636381 9:78282983-78283005 ACTGGAAGCCAAATCCAGGTTGG - Intergenic
1057163382 9:92907233-92907255 CCTGGAAGGCAAAGACCAAAAGG + Intergenic
1057369133 9:94454008-94454030 TCTGGAAGCCCAAGCCAAGGAGG - Exonic
1057714119 9:97476042-97476064 CCTGGAAGACACAGACAGGAAGG - Intronic
1057781734 9:98056089-98056111 CCAGAAAGCCAAAGCAGAGATGG - Intergenic
1059365852 9:113785972-113785994 CATGTCAGCCAAAGGCAAGAAGG + Intergenic
1059421604 9:114195937-114195959 CCTGGAAGACACAGACAAGGTGG - Exonic
1059655334 9:116352684-116352706 CCTGGAAGACATAGGCAAGCAGG - Exonic
1060033122 9:120232739-120232761 GCTGGAAGCCACAGACAGGATGG + Intergenic
1060069790 9:120536055-120536077 CCTGGGAGCCAAAGGAAAAAGGG - Intronic
1060242863 9:121919548-121919570 CCTGGTAGCCAAAGGAAAGAAGG + Intronic
1060432016 9:123558548-123558570 CCTAGTAGCCAAAGCAAGGAGGG + Intronic
1060478932 9:124006214-124006236 CCTGGAAGCAAAACCAAAAAAGG - Intronic
1061232369 9:129322210-129322232 CCTGGGTGCCATGGCCAAGATGG - Intergenic
1061292103 9:129656354-129656376 CCTGGTAGCCAAGGCAAAAAGGG + Intergenic
1061977023 9:134074060-134074082 TGTGGATGGCAAAGCCAAGATGG - Intergenic
1062315817 9:135966579-135966601 CCTGGAAGCAGAAGCTGAGATGG - Intergenic
1062453808 9:136626580-136626602 CCGGGAAGCCAGAGCCACGACGG + Intergenic
1062560641 9:137140127-137140149 CCTGGAAGCAGAAACAAAGATGG - Intronic
1186357275 X:8801102-8801124 GGTGGACTCCAAAGCCAAGAAGG + Intronic
1186792829 X:13015647-13015669 CCTGGAAGCTTAAGCAATGATGG - Intergenic
1187540203 X:20185700-20185722 CCTGGAAGTCCTAGCCAATATGG - Intronic
1188536415 X:31201658-31201680 CCTGACAACCAAATCCAAGAGGG + Intronic
1188872252 X:35387544-35387566 CTTGGAAACTAAAGGCAAGAGGG - Intergenic
1189211686 X:39289258-39289280 CCAGGAAGCCAATCCTAAGATGG + Intergenic
1189282076 X:39825954-39825976 CCAGGAAGCAAATGCTAAGATGG - Intergenic
1189297627 X:39930020-39930042 CCTGGAAGCCAATGACAGCAGGG + Intergenic
1191077992 X:56476156-56476178 CCTGGAAATCAAAGCCCAAAGGG + Intergenic
1192250297 X:69407596-69407618 CCTGAAGGCCTAAGCCAGGATGG + Intergenic
1193836202 X:86347929-86347951 ACTGGAAGCAAAAGCTGAGAGGG - Intronic
1194010105 X:88551127-88551149 ACTGGAAGCCAAAGCCAAAATGG - Intergenic
1194621347 X:96176233-96176255 CTTGAAGGCCAAAGGCAAGAAGG + Intergenic
1196479574 X:116131264-116131286 ACTGGCAGCCAAAGCAAAAATGG - Intergenic
1196862854 X:120043873-120043895 CTTGAAGGCCAAAGGCAAGATGG - Intergenic
1196880248 X:120192471-120192493 CTTGAAGGCCAAAGGCAAGATGG + Intergenic
1197242734 X:124137139-124137161 CCTGGCAGCCAAGGCAGAGAGGG - Intronic
1197657844 X:129136874-129136896 TGTGGAAGCCAGAGTCAAGAGGG + Intergenic
1199470977 X:148195787-148195809 CCTGGAAGCTAAAGTGAAAAAGG + Intergenic