ID: 1119400354

View in Genome Browser
Species Human (GRCh38)
Location 14:74358503-74358525
Sequence GAGAAGCAGGAGAAGGAGGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2992
Summary {0: 1, 1: 2, 2: 28, 3: 351, 4: 2610}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119400335_1119400354 30 Left 1119400335 14:74358450-74358472 CCAAACTTCAGGTGCCGGTCCCC 0: 1
1: 0
2: 0
3: 2
4: 87
Right 1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG 0: 1
1: 2
2: 28
3: 351
4: 2610
1119400348_1119400354 6 Left 1119400348 14:74358474-74358496 CCTTGGGCAAAGGGGGGCAGGAG 0: 1
1: 0
2: 3
3: 32
4: 354
Right 1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG 0: 1
1: 2
2: 28
3: 351
4: 2610
1119400345_1119400354 10 Left 1119400345 14:74358470-74358492 CCCACCTTGGGCAAAGGGGGGCA 0: 1
1: 0
2: 0
3: 7
4: 136
Right 1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG 0: 1
1: 2
2: 28
3: 351
4: 2610
1119400344_1119400354 11 Left 1119400344 14:74358469-74358491 CCCCACCTTGGGCAAAGGGGGGC 0: 1
1: 0
2: 0
3: 9
4: 141
Right 1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG 0: 1
1: 2
2: 28
3: 351
4: 2610
1119400338_1119400354 16 Left 1119400338 14:74358464-74358486 CCGGTCCCCACCTTGGGCAAAGG 0: 1
1: 0
2: 4
3: 20
4: 229
Right 1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG 0: 1
1: 2
2: 28
3: 351
4: 2610
1119400346_1119400354 9 Left 1119400346 14:74358471-74358493 CCACCTTGGGCAAAGGGGGGCAG 0: 1
1: 0
2: 2
3: 14
4: 212
Right 1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG 0: 1
1: 2
2: 28
3: 351
4: 2610

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119400354 Original CRISPR GAGAAGCAGGAGAAGGAGGC TGG Exonic
Too many off-targets to display for this crispr