ID: 1119400620

View in Genome Browser
Species Human (GRCh38)
Location 14:74359876-74359898
Sequence GAGCGTCTTCTCGGAGCTGG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 146
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 126}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119400615_1119400620 11 Left 1119400615 14:74359842-74359864 CCTGGCTGTCAGTTGGGGATTCC 0: 1
1: 0
2: 1
3: 6
4: 135
Right 1119400620 14:74359876-74359898 GAGCGTCTTCTCGGAGCTGGAGG 0: 1
1: 0
2: 1
3: 18
4: 126
1119400608_1119400620 29 Left 1119400608 14:74359824-74359846 CCTGCAGTCCTCGGCCAGCCTGG 0: 1
1: 0
2: 6
3: 151
4: 3459
Right 1119400620 14:74359876-74359898 GAGCGTCTTCTCGGAGCTGGAGG 0: 1
1: 0
2: 1
3: 18
4: 126
1119400607_1119400620 30 Left 1119400607 14:74359823-74359845 CCCTGCAGTCCTCGGCCAGCCTG 0: 1
1: 0
2: 1
3: 29
4: 312
Right 1119400620 14:74359876-74359898 GAGCGTCTTCTCGGAGCTGGAGG 0: 1
1: 0
2: 1
3: 18
4: 126
1119400614_1119400620 15 Left 1119400614 14:74359838-74359860 CCAGCCTGGCTGTCAGTTGGGGA 0: 1
1: 0
2: 4
3: 42
4: 475
Right 1119400620 14:74359876-74359898 GAGCGTCTTCTCGGAGCTGGAGG 0: 1
1: 0
2: 1
3: 18
4: 126
1119400610_1119400620 21 Left 1119400610 14:74359832-74359854 CCTCGGCCAGCCTGGCTGTCAGT 0: 1
1: 0
2: 7
3: 21
4: 334
Right 1119400620 14:74359876-74359898 GAGCGTCTTCTCGGAGCTGGAGG 0: 1
1: 0
2: 1
3: 18
4: 126
1119400616_1119400620 -10 Left 1119400616 14:74359863-74359885 CCACCTTTCTGCTGAGCGTCTTC 0: 1
1: 0
2: 1
3: 10
4: 180
Right 1119400620 14:74359876-74359898 GAGCGTCTTCTCGGAGCTGGAGG 0: 1
1: 0
2: 1
3: 18
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119400620 Original CRISPR GAGCGTCTTCTCGGAGCTGG AGG Exonic
900894429 1:5473435-5473457 GTGCGGCTTCTCGGAGCAGCTGG - Intergenic
903441033 1:23388014-23388036 GAGTGTCTACTGTGAGCTGGTGG - Intronic
914393648 1:147243560-147243582 GAGCGGGGTCTCGGAGCTGCAGG - Intronic
918071153 1:181134158-181134180 GAGCGCCTGCTCTGTGCTGGGGG - Intergenic
919926655 1:202194985-202195007 GAGCTTCCCCTCAGAGCTGGAGG + Intronic
921766913 1:218983259-218983281 TAGCTCCTTCTCGCAGCTGGTGG + Intergenic
923348815 1:233083479-233083501 CAGCCTCTTCTCGCTGCTGGTGG - Intronic
1065215228 10:23441046-23441068 GAATGTTTTCTCAGAGCTGGAGG + Exonic
1067093857 10:43285837-43285859 GAGCGTGTTCTGGGACCTGAGGG - Intergenic
1067583876 10:47463397-47463419 GAGAGTCTTCTCAGAATTGGAGG + Intronic
1067633879 10:47988745-47988767 GAGAGTCTTCTCAGAATTGGAGG + Intergenic
1069829426 10:71273485-71273507 GAGGGTCTTCTCAGAGGAGGGGG - Intronic
1070152144 10:73811575-73811597 GAGCGTTCGCTCGGAGATGGCGG - Exonic
1071356091 10:84797625-84797647 GAGTCTCTTCTACGAGCTGGAGG - Intergenic
1073141080 10:101248205-101248227 GGGCCTTTTCTCGGAGATGGAGG + Intergenic
1074186921 10:111105767-111105789 AAGCGTCTTCTGGGAGCCAGGGG - Intergenic
1074981013 10:118620004-118620026 GAGCGCCTCCTGGGAGCTGCTGG - Intergenic
1079326080 11:19493769-19493791 TAGCATCTTCTCTGACCTGGAGG + Intronic
1091262498 11:134245592-134245614 CAGCATCTTCTCGGCCCTGGGGG - Exonic
1092507073 12:9113395-9113417 GAGCCTCTTCACTGACCTGGAGG - Exonic
1092515187 12:9203803-9203825 GAGCCTCTTCACTGACCTGGTGG - Exonic
1095465444 12:42483801-42483823 GAGGGTCTCTGCGGAGCTGGAGG - Intronic
1098572730 12:72007200-72007222 GAGCTTCTCCTTGGAGATGGAGG + Intronic
1103248323 12:119477544-119477566 GAACCTCTTCTCTGAGCTGGGGG - Intronic
1103561216 12:121794087-121794109 GGGGCTCTTCCCGGAGCTGGAGG - Exonic
1103741525 12:123094724-123094746 GAGCTGCTTCTAGGAGGTGGAGG - Intronic
1104895205 12:132160599-132160621 GAGCTTCTTCACAGAGGTGGTGG + Intergenic
1104901884 12:132193880-132193902 GAGCTTCTTCTCAGAGCAGAGGG + Intergenic
1108263016 13:48677267-48677289 GAGGGTCTCCTCTGAGGTGGAGG + Intronic
1111289545 13:86146539-86146561 GAACGTCTTTTCTGAGCTGAGGG + Intergenic
1113607398 13:111620176-111620198 GAGAGCCCTCTGGGAGCTGGTGG + Intronic
1117282214 14:54252351-54252373 GAAAGTCTTCTAGGAGCTGCTGG + Intergenic
1117453830 14:55878123-55878145 GAGAGCCTTCCAGGAGCTGGCGG + Intergenic
1119400620 14:74359876-74359898 GAGCGTCTTCTCGGAGCTGGAGG + Exonic
1119937711 14:78608131-78608153 GAGAGTCTTGGCGGAGATGGTGG + Intronic
1122560023 14:102606537-102606559 GAGAGTGTTCTGGGAGCTAGTGG + Intronic
1123014692 14:105368099-105368121 GAGCTTCTCCTCCGAGCAGGAGG + Exonic
1124190698 15:27574222-27574244 CAGCCTATTCTGGGAGCTGGTGG + Intergenic
1124959294 15:34382793-34382815 GAGCGACTTGGAGGAGCTGGTGG - Exonic
1124975920 15:34529014-34529036 GAGCGACTTGGAGGAGCTGGTGG - Exonic
1127261735 15:57331585-57331607 GGGCCTCTTCTGGGTGCTGGGGG - Intergenic
1128730677 15:70018868-70018890 GAGCAGCTTCAGGGAGCTGGTGG - Intergenic
1129468878 15:75739145-75739167 GTTCATCTTCTCGGAGCTGCTGG - Intergenic
1129887174 15:79046784-79046806 GGGAGGCTTCTTGGAGCTGGCGG + Exonic
1133316052 16:4884748-4884770 GAGGGTCTTCTTGGAATTGGAGG + Exonic
1135303050 16:21347258-21347280 GTCCGTCTTCTCCGATCTGGTGG - Intergenic
1136299791 16:29326450-29326472 GTCCGTCTTCTCCGATCTGGTGG - Intergenic
1142001514 16:87667015-87667037 GAGCTTCTGCCCGGAGCTGGGGG - Intronic
1142061522 16:88033212-88033234 GTCCGTCTTCTCCGATCTGGTGG - Exonic
1142967658 17:3591308-3591330 GAGGGTCTTCTCGGTGCTGGCGG + Exonic
1145797735 17:27665729-27665751 GAGCATCTACTGGGAGCTGAGGG - Intergenic
1146842201 17:36163927-36163949 GAGCGTCTACTGGGAGCTGAAGG - Intergenic
1146854510 17:36251886-36251908 GAGTGTCTACTGGGAGCTGAAGG - Intronic
1146866109 17:36336490-36336512 GAGCGTCTACTGGGAGCTGAAGG + Intronic
1146870412 17:36375778-36375800 GAGCGTCTACTGGGAGCTGAAGG - Intronic
1146877768 17:36426859-36426881 GAGCGTCTACTGGGAGCTGAAGG - Intronic
1147068978 17:37937102-37937124 GAGCGTCTACTGGGAGCTGAAGG + Intergenic
1147073294 17:37976402-37976424 GAGCGTCTACTGGGAGCTGAAGG - Intergenic
1147080503 17:38016639-38016661 GAGCGTCTACTGGGAGCTGAAGG + Intronic
1147084815 17:38055940-38055962 GAGCGTCTACTGGGAGCTGAAGG - Intronic
1147096449 17:38140599-38140621 GAGCGTCTACTGGGAGCTGAAGG + Intergenic
1147100763 17:38179906-38179928 GAGCGTCTACTGGGAGCTGAAGG - Intergenic
1147159836 17:38563330-38563352 CAACGTCTTCTACGAGCTGGAGG - Exonic
1147845111 17:43399371-43399393 GAGCCTCTTCTCAGAGCTTATGG - Intronic
1149845352 17:60006370-60006392 GAGCGTCTACTGGGAGCTGAAGG - Intergenic
1150083696 17:62262953-62262975 GAGTGTCTACTGGGAGCTGAAGG - Intergenic
1151615236 17:75205730-75205752 GAGCGACTTCTAGGAGCCTGGGG + Exonic
1157578829 18:48761526-48761548 CAGCATCTCCTCGGAGTTGGTGG - Exonic
1161868555 19:6852952-6852974 GTCCGCCTTCTAGGAGCTGGTGG + Exonic
1162033500 19:7927190-7927212 GAGAATCTGCTCGGTGCTGGAGG + Exonic
1162395527 19:10416496-10416518 AAGCGTCTCCTCCGAGCTGTTGG - Intronic
1162468643 19:10858669-10858691 GACCGTTTTCTGGCAGCTGGAGG - Intronic
1163417362 19:17194786-17194808 GAGAGTCTTCTCTGGGCTTGGGG - Exonic
1164579594 19:29426248-29426270 GAGCATCTTCTCTGCCCTGGCGG - Intergenic
1166290394 19:41859989-41860011 GAGCTCCTGTTCGGAGCTGGGGG - Exonic
928884401 2:36131609-36131631 GAGCTTCTTCTAGCTGCTGGAGG - Intergenic
932496751 2:72149389-72149411 GAGGGACTGCTCGGAGCTGGAGG - Intergenic
934849896 2:97691441-97691463 GAGCCTCTGCTCCTAGCTGGAGG - Intergenic
934933256 2:98445290-98445312 CCGCGTCTTCACGGGGCTGGGGG - Intronic
948826466 2:240575564-240575586 GAGCTTCTTCCCGGAGCTGAAGG + Exonic
949000695 2:241611146-241611168 GAGGGGCCTCTGGGAGCTGGGGG + Intronic
1172493797 20:35363461-35363483 AAGGGTCCTCTAGGAGCTGGAGG + Intronic
1172781379 20:37438680-37438702 GAGCGCCTCCTGGGAGCCGGCGG + Intergenic
1173201365 20:40957583-40957605 ATGTGACTTCTCGGAGCTGGTGG + Intergenic
1175975522 20:62708684-62708706 GCGCGTCTCCACGGAGCCGGCGG - Intergenic
1176114173 20:63423912-63423934 GGGCGGCTTCTCGGGGGTGGGGG - Intronic
1177176881 21:17709031-17709053 GAGTGGCTTCTAGGAGCTGAAGG - Intergenic
1177755357 21:25340704-25340726 GAGTCTATTCTTGGAGCTGGAGG - Intergenic
1179988174 21:44932529-44932551 GACTGCCTTCCCGGAGCTGGCGG - Intergenic
1180139017 21:45880165-45880187 TGGCCTCTTCTGGGAGCTGGTGG + Intronic
1181328875 22:22073951-22073973 GAGCTTCTCCTGGGAGCTGATGG - Intergenic
1182304908 22:29361242-29361264 GAGCCCCTTCCCGGAGCTGCTGG + Intronic
1182312222 22:29417377-29417399 GAGCCCCTTCCCGGAGCTGCTGG + Intronic
1182688043 22:32135865-32135887 GAGCTCCTTCCCGGAGCTGCTGG - Intergenic
1182744860 22:32597746-32597768 GGCCGTGTTCTAGGAGCTGGGGG - Intronic
1183737573 22:39652301-39652323 GAGCCTCTTCTGGGAGCAGCAGG + Intronic
1184388362 22:44188922-44188944 GAGGGTCTCCTGGAAGCTGGAGG + Intronic
951110146 3:18793635-18793657 GAGCATCCTGTCGGACCTGGTGG - Intergenic
951725011 3:25748070-25748092 CAGAGTCTTCTCTGAACTGGGGG + Intronic
952816798 3:37453126-37453148 CAGGGTCTTGTAGGAGCTGGGGG - Intronic
958520840 3:95184143-95184165 GAGCTTCTTCTGGCATCTGGCGG - Intergenic
960223669 3:115146672-115146694 GAGCGTCTTCAGAGAACTGGGGG - Intronic
963779633 3:149474532-149474554 GAGTGTCTTGTCTGTGCTGGTGG + Exonic
965774125 3:172210191-172210213 GGGCGGCTTCGTGGAGCTGGCGG - Intronic
969523443 4:7692144-7692166 GAGCATCTGCTGGGAGCAGGAGG + Intronic
979530570 4:121765257-121765279 GCGCGTTTCCTCGGAGCCGGGGG - Intronic
981871209 4:149487795-149487817 GTGCCTCTTCTGGGAGATGGGGG + Intergenic
987080026 5:14418119-14418141 GAGGGACTTCTCGGAGCCAGTGG + Intronic
988054430 5:26075037-26075059 GAGAGTCTTGTCTGAGCTGGGGG + Intergenic
992877629 5:81073392-81073414 GGGGGGCTTCTTGGAGCTGGCGG - Exonic
997585861 5:135042887-135042909 GAACAACTTCTCTGAGCTGGTGG + Intronic
998810377 5:145960380-145960402 GAGCTTCTTTTCTGGGCTGGTGG - Intronic
1006848266 6:37078235-37078257 TAGCTTCTTCTTGGAGCTGGAGG + Intergenic
1014104539 6:117547673-117547695 CAGGGTCTTCTCAGAGATGGGGG - Intronic
1018984924 6:168629086-168629108 AAGCCTCCTCTCGGAGCTCGAGG - Intronic
1019658550 7:2210850-2210872 GAGCGTCCTCTCTGAGCAGCCGG - Intronic
1019750905 7:2729131-2729153 GAGCCTCTTCGCGGCGCTGTTGG - Exonic
1022411989 7:30146238-30146260 GAGCGTCTTCTTGCCGCAGGAGG - Exonic
1023117392 7:36875742-36875764 GAGGGTCTTAGCAGAGCTGGGGG + Intronic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1024354715 7:48402846-48402868 GAGTGTCTCCTCGGAGCTGCAGG - Intronic
1028585480 7:92447598-92447620 GAGCGTCGGCACGGAGCTGCCGG - Exonic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1030272920 7:107689080-107689102 GAGCTTGTTCTCGGAGATGCTGG + Exonic
1033302143 7:140196118-140196140 GGCCCTCTTCTAGGAGCTGGGGG + Intergenic
1034324216 7:150215738-150215760 GAGAGTTTTTTCGGACCTGGTGG + Intergenic
1034768978 7:153753498-153753520 GAGAGTTTTTTCGGACCTGGTGG - Intergenic
1035718358 8:1771234-1771256 GAAGGTCTTCTGGGACCTGGCGG + Exonic
1037730986 8:21523967-21523989 CAGCGTCTTCAGGGAGCTAGTGG - Intergenic
1042884575 8:73533849-73533871 CAACTTCTTTTCGGAGCTGGGGG - Intronic
1045942023 8:107750435-107750457 GACCGTCTTCTCAGAGCAGATGG + Intergenic
1047821558 8:128526690-128526712 GATCGACATCTCGGTGCTGGGGG + Intergenic
1048603916 8:135947775-135947797 CAGTCTCTTCTCAGAGCTGGAGG - Intergenic
1049014467 8:139909911-139909933 AAAGGTCTTCTCGGAGCCGGTGG - Intronic
1051074567 9:13216009-13216031 GGGTGTCTTCACTGAGCTGGTGG - Intronic
1057076857 9:92142425-92142447 GAGCTTCCCCTCAGAGCTGGAGG + Intergenic
1060191972 9:121599327-121599349 GAGCGTGTGCTCGGAGCGGAGGG + Intronic
1060417275 9:123440386-123440408 GCCGGTCTTCTCGGAGCTTGGGG + Exonic
1060641184 9:125240754-125240776 GACCGTGTTCTCGGGGTTGGAGG + Exonic
1060916760 9:127396712-127396734 GTGCAGCTTCTCGGAGTTGGGGG + Intergenic
1061060892 9:128250123-128250145 GTTCATCTTCTCGGAGCTGCTGG + Exonic
1062133156 9:134911108-134911130 GAGTGTCTGCTTGGGGCTGGTGG - Intronic
1062383655 9:136299639-136299661 GAGCTGCTTCTGGGGGCTGGAGG - Intronic
1189336606 X:40174337-40174359 GAGCGTCTTGTAGGGGCCGGAGG - Intronic