ID: 1119401853

View in Genome Browser
Species Human (GRCh38)
Location 14:74368104-74368126
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119401853_1119401860 15 Left 1119401853 14:74368104-74368126 CCTGGAAAAACCCCATGCGAGTA No data
Right 1119401860 14:74368142-74368164 CATTTGGCCCTCACACTCTAAGG No data
1119401853_1119401858 -1 Left 1119401853 14:74368104-74368126 CCTGGAAAAACCCCATGCGAGTA No data
Right 1119401858 14:74368126-74368148 AGGATCTTGATACAGCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119401853 Original CRISPR TACTCGCATGGGGTTTTTCC AGG (reversed) Intergenic