ID: 1119401858

View in Genome Browser
Species Human (GRCh38)
Location 14:74368126-74368148
Sequence AGGATCTTGATACAGCCATT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119401852_1119401858 6 Left 1119401852 14:74368097-74368119 CCTATAGCCTGGAAAAACCCCAT No data
Right 1119401858 14:74368126-74368148 AGGATCTTGATACAGCCATTTGG No data
1119401853_1119401858 -1 Left 1119401853 14:74368104-74368126 CCTGGAAAAACCCCATGCGAGTA No data
Right 1119401858 14:74368126-74368148 AGGATCTTGATACAGCCATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119401858 Original CRISPR AGGATCTTGATACAGCCATT TGG Intergenic