ID: 1119401860

View in Genome Browser
Species Human (GRCh38)
Location 14:74368142-74368164
Sequence CATTTGGCCCTCACACTCTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119401852_1119401860 22 Left 1119401852 14:74368097-74368119 CCTATAGCCTGGAAAAACCCCAT No data
Right 1119401860 14:74368142-74368164 CATTTGGCCCTCACACTCTAAGG No data
1119401853_1119401860 15 Left 1119401853 14:74368104-74368126 CCTGGAAAAACCCCATGCGAGTA No data
Right 1119401860 14:74368142-74368164 CATTTGGCCCTCACACTCTAAGG No data
1119401856_1119401860 4 Left 1119401856 14:74368115-74368137 CCCATGCGAGTAGGATCTTGATA No data
Right 1119401860 14:74368142-74368164 CATTTGGCCCTCACACTCTAAGG No data
1119401857_1119401860 3 Left 1119401857 14:74368116-74368138 CCATGCGAGTAGGATCTTGATAC No data
Right 1119401860 14:74368142-74368164 CATTTGGCCCTCACACTCTAAGG No data
1119401855_1119401860 5 Left 1119401855 14:74368114-74368136 CCCCATGCGAGTAGGATCTTGAT No data
Right 1119401860 14:74368142-74368164 CATTTGGCCCTCACACTCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119401860 Original CRISPR CATTTGGCCCTCACACTCTA AGG Intergenic