ID: 1119404453

View in Genome Browser
Species Human (GRCh38)
Location 14:74388897-74388919
Sequence CTGTGGGTGTGGCTGCCAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119404453_1119404466 25 Left 1119404453 14:74388897-74388919 CCATCTGGCAGCCACACCCACAG No data
Right 1119404466 14:74388945-74388967 TTCTCCCCAGTCCACAATCTGGG No data
1119404453_1119404465 24 Left 1119404453 14:74388897-74388919 CCATCTGGCAGCCACACCCACAG No data
Right 1119404465 14:74388944-74388966 ATTCTCCCCAGTCCACAATCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119404453 Original CRISPR CTGTGGGTGTGGCTGCCAGA TGG (reversed) Intergenic
No off target data available for this crispr