ID: 1119407722

View in Genome Browser
Species Human (GRCh38)
Location 14:74409277-74409299
Sequence TCTCCTTGTGTTGCTCATGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 26144
Summary {0: 1, 1: 4, 2: 223, 3: 3035, 4: 22881}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119407718_1119407722 17 Left 1119407718 14:74409237-74409259 CCAGGCTAATTTTCAATTTTTTT 0: 12
1: 555
2: 4085
3: 24609
4: 134356
Right 1119407722 14:74409277-74409299 TCTCCTTGTGTTGCTCATGCTGG 0: 1
1: 4
2: 223
3: 3035
4: 22881
1119407717_1119407722 22 Left 1119407717 14:74409232-74409254 CCACGCCAGGCTAATTTTCAATT 0: 1
1: 8
2: 481
3: 8903
4: 37949
Right 1119407722 14:74409277-74409299 TCTCCTTGTGTTGCTCATGCTGG 0: 1
1: 4
2: 223
3: 3035
4: 22881
1119407716_1119407722 25 Left 1119407716 14:74409229-74409251 CCACCACGCCAGGCTAATTTTCA 0: 5
1: 253
2: 5437
3: 82219
4: 227188
Right 1119407722 14:74409277-74409299 TCTCCTTGTGTTGCTCATGCTGG 0: 1
1: 4
2: 223
3: 3035
4: 22881

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119407722 Original CRISPR TCTCCTTGTGTTGCTCATGC TGG Intronic
Too many off-targets to display for this crispr