ID: 1119414258

View in Genome Browser
Species Human (GRCh38)
Location 14:74459123-74459145
Sequence CTCTGTCTCTGGAGGGGAGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119414252_1119414258 0 Left 1119414252 14:74459100-74459122 CCAAGGGGAGCAAGCAGCACTGT No data
Right 1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG No data
1119414251_1119414258 8 Left 1119414251 14:74459092-74459114 CCAGCAGGCCAAGGGGAGCAAGC No data
Right 1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG No data
1119414250_1119414258 9 Left 1119414250 14:74459091-74459113 CCCAGCAGGCCAAGGGGAGCAAG No data
Right 1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119414258 Original CRISPR CTCTGTCTCTGGAGGGGAGA GGG Intergenic
No off target data available for this crispr