ID: 1119415018

View in Genome Browser
Species Human (GRCh38)
Location 14:74464164-74464186
Sequence TTGTGGGTAGGGAGTGAAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119415010_1119415018 1 Left 1119415010 14:74464140-74464162 CCTGAAAGAGGCCAGAGGGTAGG No data
Right 1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG No data
1119415006_1119415018 6 Left 1119415006 14:74464135-74464157 CCTGCCCTGAAAGAGGCCAGAGG No data
Right 1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG No data
1119415004_1119415018 20 Left 1119415004 14:74464121-74464143 CCTGCTTGGTTATACCTGCCCTG No data
Right 1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG No data
1119415009_1119415018 2 Left 1119415009 14:74464139-74464161 CCCTGAAAGAGGCCAGAGGGTAG No data
Right 1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG No data
1119415015_1119415018 -10 Left 1119415015 14:74464151-74464173 CCAGAGGGTAGGGTTGTGGGTAG No data
Right 1119415018 14:74464164-74464186 TTGTGGGTAGGGAGTGAAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119415018 Original CRISPR TTGTGGGTAGGGAGTGAAAA AGG Intergenic
No off target data available for this crispr