ID: 1119415315

View in Genome Browser
Species Human (GRCh38)
Location 14:74465771-74465793
Sequence GCCCTCATGCTGATGTTCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119415315_1119415322 17 Left 1119415315 14:74465771-74465793 CCTGTGAACATCAGCATGAGGGC No data
Right 1119415322 14:74465811-74465833 GTGGGGTCTTCACTGGTTTTGGG No data
1119415315_1119415316 -2 Left 1119415315 14:74465771-74465793 CCTGTGAACATCAGCATGAGGGC No data
Right 1119415316 14:74465792-74465814 GCTGAACAGATCCATAGAAGTGG No data
1119415315_1119415321 16 Left 1119415315 14:74465771-74465793 CCTGTGAACATCAGCATGAGGGC No data
Right 1119415321 14:74465810-74465832 AGTGGGGTCTTCACTGGTTTTGG No data
1119415315_1119415318 0 Left 1119415315 14:74465771-74465793 CCTGTGAACATCAGCATGAGGGC No data
Right 1119415318 14:74465794-74465816 TGAACAGATCCATAGAAGTGGGG No data
1119415315_1119415317 -1 Left 1119415315 14:74465771-74465793 CCTGTGAACATCAGCATGAGGGC No data
Right 1119415317 14:74465793-74465815 CTGAACAGATCCATAGAAGTGGG No data
1119415315_1119415320 10 Left 1119415315 14:74465771-74465793 CCTGTGAACATCAGCATGAGGGC No data
Right 1119415320 14:74465804-74465826 CATAGAAGTGGGGTCTTCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119415315 Original CRISPR GCCCTCATGCTGATGTTCAC AGG (reversed) Intergenic
No off target data available for this crispr