ID: 1119420803

View in Genome Browser
Species Human (GRCh38)
Location 14:74506667-74506689
Sequence CCTGTGGGCTACCCAAGGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 220
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 204}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119420803_1119420816 26 Left 1119420803 14:74506667-74506689 CCAGACCTTGGGTAGCCCACAGG 0: 1
1: 0
2: 0
3: 15
4: 204
Right 1119420816 14:74506716-74506738 AGGGAGAGATCTCGAAGCCCTGG 0: 1
1: 0
2: 2
3: 12
4: 139
1119420803_1119420809 6 Left 1119420803 14:74506667-74506689 CCAGACCTTGGGTAGCCCACAGG 0: 1
1: 0
2: 0
3: 15
4: 204
Right 1119420809 14:74506696-74506718 ACCCACACAGTCCCAGCCTGAGG 0: 1
1: 0
2: 4
3: 28
4: 336
1119420803_1119420811 7 Left 1119420803 14:74506667-74506689 CCAGACCTTGGGTAGCCCACAGG 0: 1
1: 0
2: 0
3: 15
4: 204
Right 1119420811 14:74506697-74506719 CCCACACAGTCCCAGCCTGAGGG 0: 1
1: 0
2: 2
3: 46
4: 277

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119420803 Original CRISPR CCTGTGGGCTACCCAAGGTC TGG (reversed) Intronic
901202734 1:7475872-7475894 CCTGTGGGCTCCCCCAGGACAGG - Intronic
902956991 1:19932184-19932206 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
903827486 1:26156413-26156435 CCTGTGGGCAGCGCAGGGTCAGG - Intergenic
904115390 1:28158085-28158107 CCTGTGAGCTGCTCAAGGGCTGG - Intronic
904242421 1:29156755-29156777 CCCGTAGGGTACCCAAAGTCTGG + Intronic
904249176 1:29210424-29210446 CCTGTGGGCTTCCCCCGGACTGG + Intronic
910507345 1:87964736-87964758 CCTGTGGACTACCCAGGTGCTGG - Intergenic
911601620 1:99853960-99853982 CATGTGGGTCACCCCAGGTCAGG + Intronic
915316068 1:155029883-155029905 ACTGCGGGCTCCCCAAGGACCGG + Intronic
919990240 1:202704308-202704330 CCTGGGCGCTCCCCAAGGCCAGG - Intronic
922045234 1:221939019-221939041 ACTGTGGCCTCCCCAAGGTAGGG + Intergenic
1064034805 10:11906591-11906613 CAGGTGGATTACCCAAGGTCAGG + Intergenic
1066654472 10:37685671-37685693 CCTGTAGGGTACCCAAAGTCCGG - Intergenic
1067410258 10:46058326-46058348 CGGGTGGACTACCTAAGGTCAGG - Intergenic
1067427630 10:46221644-46221666 CCTGTGGGCTTTCCAATGTCTGG + Intergenic
1067583051 10:47457557-47457579 CCTGTGGGCTTTCCAATGTCTGG + Intergenic
1068206766 10:53864569-53864591 CCTGTGGGCTACCCCTTATCTGG - Intronic
1068353688 10:55882773-55882795 CCAGTGGGCCACCTGAGGTCAGG + Intergenic
1068834449 10:61538400-61538422 GCTGTCAGCTACCCAAGGGCAGG + Intergenic
1069564877 10:69457171-69457193 ACTGTGGGCTCCCAGAGGTCAGG + Intronic
1069926296 10:71852851-71852873 CCTTTGGGCTTCCCAAGGCCAGG + Intergenic
1072591790 10:96833271-96833293 CCCGAGGGCGGCCCAAGGTCCGG - Intronic
1072694208 10:97590951-97590973 TCTGTGGGCAGCCTAAGGTCTGG + Intronic
1075279668 10:121128799-121128821 ACTGTGGACTTCCCAAGGACAGG + Intergenic
1075810096 10:125218914-125218936 CCTGGGTGCTGCCCAAGGCCAGG - Intergenic
1078153317 11:8777247-8777269 CCTCTTGGCTATCCAAGGTGGGG - Intronic
1080911064 11:36599219-36599241 CAGGTGGGTCACCCAAGGTCAGG - Intronic
1081674391 11:44960114-44960136 GCTGTGAGCTACTCAAGGGCAGG + Intergenic
1084596541 11:70120101-70120123 CCTGTGAGGTATCCAGGGTCAGG - Intronic
1085013310 11:73156454-73156476 GCTGTGGGCTCCTCAAGGCCAGG - Intergenic
1085212231 11:74791525-74791547 CCTCTGGGGTGCCCAAAGTCTGG + Intronic
1085282191 11:75338419-75338441 CCTGTGGGCAGCCCCAGTTCAGG - Intronic
1085287620 11:75374232-75374254 CCTGCGGGTCACCCTAGGTCAGG - Intergenic
1085958678 11:81433227-81433249 GCTGAGGCCTACCCAGGGTCAGG + Intergenic
1086694950 11:89832684-89832706 CAGGTGGACTACCTAAGGTCAGG + Intergenic
1086711198 11:90011812-90011834 CAGGTGGACTACCTAAGGTCAGG - Intergenic
1088439031 11:109847912-109847934 ACTGTGGGCTTCTCAAGGACAGG + Intergenic
1088835996 11:113578354-113578376 CCTGGGGGTACCCCAAGGTCAGG + Intergenic
1090804153 11:130192052-130192074 CCTGTGGGATACCCCACGTCAGG + Intronic
1090960859 11:131555545-131555567 CCTGTGGCATACCCAATGACAGG + Intronic
1091797049 12:3303527-3303549 CCTGTGAGCCACTCAAGGCCAGG - Intergenic
1092871560 12:12810313-12810335 CCCGTAGGGTACCCAAAGTCCGG + Intronic
1099350133 12:81556770-81556792 CCTGGGGGCTACCCATTGTTGGG + Intronic
1101333265 12:103774452-103774474 CAGGTGGATTACCCAAGGTCAGG + Exonic
1101813057 12:108124129-108124151 CATGTGTGCTCCCCCAGGTCTGG + Intergenic
1103099443 12:118159770-118159792 ACTGTGGGCTCCCTAAGGGCAGG + Intronic
1103289869 12:119836405-119836427 CCTGTGGGCTCCTCGAGGACTGG - Intronic
1104609440 12:130216375-130216397 CCTGTGGGCTCCTCCAGGCCTGG - Intergenic
1105039341 12:132949524-132949546 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1106038461 13:26067140-26067162 CTGGTGGGCCACCTAAGGTCAGG - Intergenic
1107795641 13:44048759-44048781 CCTGTAGCCTCCCAAAGGTCAGG + Intergenic
1110671605 13:78186691-78186713 CCTCTGGGCCTCCCAAGGGCAGG + Intergenic
1111304063 13:86383059-86383081 GCTCAGGGATACCCAAGGTCTGG - Intergenic
1112565472 13:100548119-100548141 CTTGTGTGCTCCCAAAGGTCTGG + Intronic
1116874381 14:50096625-50096647 CCTGTGGGTTAGCCTCGGTCAGG + Intergenic
1119420803 14:74506667-74506689 CCTGTGGGCTACCCAAGGTCTGG - Intronic
1122898863 14:104773854-104773876 CCTGTGGGCCGCCCATGGTGGGG - Intronic
1125753049 15:42043373-42043395 CCTGTGGGCACCCGTAGGTCAGG + Intronic
1127536128 15:59891472-59891494 CCAGTGAGTTCCCCAAGGTCAGG - Intergenic
1128074540 15:64818075-64818097 CCTTAGGGCTACCCCAGGTGCGG - Exonic
1128525718 15:68410963-68410985 CCTGGGGGCTTCCCAGGGTGAGG - Intronic
1129685454 15:77683935-77683957 CCTCTGGGCAACCCCAGCTCTGG + Intronic
1130535633 15:84783302-84783324 CCTGCTGGCTCCCCAAGGGCAGG - Exonic
1130656999 15:85798720-85798742 CCTGTGGGCTTCCCCATCTCAGG + Intergenic
1131057196 15:89382365-89382387 CCTGTAAGCTAAGCAAGGTCAGG - Intergenic
1131506307 15:93022733-93022755 CCAGTTGGCTTCCCAAGGTGAGG - Intronic
1132379797 15:101358507-101358529 CCTGTGGGCTCCTCAGGGGCAGG + Intronic
1132655503 16:1040349-1040371 CCTGAGGGCCCCCCAAGGTTCGG + Intergenic
1132870880 16:2115305-2115327 CCTGTCTGCTGCCCAGGGTCTGG - Intronic
1134001409 16:10785897-10785919 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1134274321 16:12762139-12762161 CCTGGGGTCTGCCCAAGGGCAGG + Intronic
1134521645 16:14921578-14921600 CCTGTCTGCTGCCCAGGGTCTGG + Intronic
1134709316 16:16320229-16320251 CCTGTCTGCTGCCCAGGGTCTGG + Intergenic
1134716527 16:16360258-16360280 CCTGTCTGCTGCCCAGGGTCTGG + Intergenic
1134950288 16:18348416-18348438 CCTGTCTGCTGCCCAGGGTCTGG - Intergenic
1134958223 16:18391901-18391923 CCTGTCTGCTGCCCAGGGTCTGG - Intergenic
1136685781 16:31994200-31994222 CAGCTGGGCTACCCCAGGTCAGG + Intergenic
1136786394 16:32937733-32937755 CAGCTGGGCTACCCCAGGTCAGG + Intergenic
1136883378 16:33916062-33916084 CAGCTGGGCTACCCCAGGTCAGG - Intergenic
1136983987 16:35083110-35083132 CTTGTGGGCTCCCCAAGCCCTGG + Intergenic
1138424555 16:56922143-56922165 CCGGTGGATAACCCAAGGTCAGG + Intergenic
1138518114 16:57550203-57550225 CGGGTGGGTCACCCAAGGTCAGG - Intronic
1139367429 16:66442050-66442072 CCTCTGGGCTGCCCTGGGTCAGG - Intronic
1140092395 16:71849354-71849376 CCTGTGGGCTCCACAAGCCCAGG - Intronic
1140226011 16:73078030-73078052 CAGGTGGACCACCCAAGGTCAGG - Intergenic
1203088628 16_KI270728v1_random:1199399-1199421 CAGCTGGGCTACCCCAGGTCAGG + Intergenic
1143034999 17:3989649-3989671 CCAGTGGGCTGCCCCGGGTCAGG + Intergenic
1143621440 17:8082802-8082824 CCTGTAGGGTACCCAAAGTCCGG - Intronic
1143646727 17:8235069-8235091 CCTGTGGGCTACCAAGGCCCTGG - Exonic
1144745154 17:17609122-17609144 CCTGTGGGCTCCTCAAGGGGAGG + Intergenic
1144761642 17:17710650-17710672 CCTTGTGGCTACCCAAGGACTGG + Intronic
1145173375 17:20678963-20678985 ACTGTGGGCTTCCTAAGGCCAGG + Intergenic
1145225004 17:21121203-21121225 ACTGTGGGCTCCCAAAGTTCTGG - Intergenic
1146907848 17:36629561-36629583 CCCTTGGCCTACCCTAGGTCGGG - Intergenic
1147146734 17:38489873-38489895 CAGCTGGGCTACCCCAGGTCAGG + Intronic
1147426649 17:40348901-40348923 GCTGTGGGCTCCCCAGTGTCTGG + Intronic
1148336960 17:46848437-46848459 CCTGTGGGCTCCTGAAGGGCTGG - Intronic
1148698100 17:49573154-49573176 GCTGTCGGCCACCCAAGGGCAGG - Intergenic
1149005119 17:51797278-51797300 TCTGTGGACTTCCCACGGTCAGG + Intronic
1150155251 17:62847804-62847826 CTGGTGGATTACCCAAGGTCGGG + Intergenic
1150757009 17:67923705-67923727 CAGGTGGATTACCCAAGGTCAGG - Intronic
1151473077 17:74329986-74330008 CCTCTGGGCTCCCCAGGGGCAGG + Intronic
1152295921 17:79466847-79466869 CGTGTGGGCTGCCCTAGGTGGGG - Intronic
1152446149 17:80345469-80345491 CCTGGGGGATCCCTAAGGTCAGG - Exonic
1152751414 17:82064141-82064163 TCTGTGGGCAGCCCAAGTTCAGG + Exonic
1157249403 18:46081435-46081457 CCGGTGGACCACCTAAGGTCAGG + Exonic
1158615050 18:58979613-58979635 CAGGTGGGTCACCCAAGGTCAGG - Intronic
1158719975 18:59916199-59916221 CCTGTGAGCTAGCAAAGGCCAGG - Intergenic
1160409104 18:78662949-78662971 TCTGTGGGCTTCACAGGGTCAGG + Intergenic
1160578491 18:79870351-79870373 CCCGTGGGCTCTCCATGGTCAGG + Intronic
1161028802 19:2048649-2048671 CCCGTGGGAGACCCAAGGCCAGG + Intronic
1161077552 19:2293585-2293607 CCGGTGGATTACCCGAGGTCAGG - Intronic
1161965550 19:7545957-7545979 ACGGTGGGCTGCCCAAGGGCAGG - Intronic
1164291833 19:23876602-23876624 CCTGTGGGGTACCTGAAGTCCGG + Intergenic
1164495196 19:28754289-28754311 CCTTTGGGCTACACAAAGGCTGG - Intergenic
1164853642 19:31504087-31504109 CCTGCAGGCTACCCCAGGTGGGG - Intergenic
1164903293 19:31946573-31946595 CCTGGGGGCAAATCAAGGTCTGG - Intergenic
1166742294 19:45121833-45121855 GCAGTGGGCTTCCCAAGGGCAGG - Intronic
1166837940 19:45678588-45678610 CGGGTGGACTACCCAAGGTTAGG - Intronic
1166897208 19:46031421-46031443 CCCGTAGGGTACCCAAAGTCCGG - Intergenic
1166975992 19:46605345-46605367 CCTCTGCCCTACCCAAGGACTGG + Intronic
1167761663 19:51453803-51453825 CCTGTGAGCTTCCCCAGGTCAGG - Intronic
1168258990 19:55182296-55182318 CCGGTGGATCACCCAAGGTCAGG + Intronic
925332461 2:3069409-3069431 CCCGTGGGGCACCCAAGGACGGG - Intergenic
926625533 2:15086555-15086577 CCTGTGAGCTTCCCAAGTTAGGG + Intergenic
927456019 2:23250000-23250022 ACTGTGAACTACTCAAGGTCAGG - Intergenic
930109589 2:47667242-47667264 CCTGTGAGCTCCTCAAGGGCAGG - Intergenic
931986441 2:67746921-67746943 ACTGTGAGCTCCCCAAGGTCAGG + Intergenic
937343557 2:121108063-121108085 CCTGTGGGCTAACCAGGGGTGGG - Intergenic
937531888 2:122838564-122838586 CCTTTGACCTACTCAAGGTCGGG - Intergenic
946248051 2:218398424-218398446 CCCGTGGGCTACCCAGGAGCAGG + Intronic
947528423 2:230893585-230893607 CCTGGGGACTACCCCAGGACGGG - Intergenic
947981813 2:234416893-234416915 CCTGTGGGCTGCCAATGGGCTGG + Intergenic
1168987570 20:2063446-2063468 CCAGTGGATCACCCAAGGTCAGG - Intergenic
1169541114 20:6600669-6600691 GCTGTGGGCTGCCCTAGGTAGGG + Intergenic
1169711334 20:8567425-8567447 CCTGTGGACAACCCAATGCCTGG + Intronic
1170424203 20:16222501-16222523 GCTGTGAGCTACCCAATCTCTGG - Intergenic
1170624076 20:18018258-18018280 GCTGTGGGCTACCCCTGGTCAGG - Intronic
1171119719 20:22557925-22557947 CCTGGGGGGTCCCCAAAGTCGGG + Intergenic
1171307175 20:24116667-24116689 CCTGTGGGCTACCCTTCATCTGG + Intergenic
1172975255 20:38901267-38901289 TCTGTGGGGTACACAAGGGCAGG - Intronic
1173145225 20:40519191-40519213 ACTGTGAACTTCCCAAGGTCAGG + Intergenic
1174272311 20:49378551-49378573 CCTGTGGCATCCCCAATGTCTGG - Intronic
1174484037 20:50850403-50850425 TCTGTGAGCTTCCCAAGGGCAGG + Intronic
1175437885 20:58967318-58967340 CAGGTGGATTACCCAAGGTCAGG - Intergenic
1179549884 21:42137282-42137304 CCTGTGGGTTACCAAAGCTGAGG - Intronic
1179833780 21:44014654-44014676 CAGGTGGACAACCCAAGGTCAGG - Intronic
1180056441 21:45361505-45361527 CATGTGGGCTACCCAAGGAGTGG + Intergenic
1181553188 22:23652659-23652681 CCCCTGGGCTCCCCAAGGTTGGG + Intergenic
1181765449 22:25088332-25088354 CCAGTGGATTACCTAAGGTCAGG - Intronic
1184148931 22:42627499-42627521 CCTGGGAGCTACCAGAGGTCAGG - Intronic
1184220924 22:43099333-43099355 CCTGTGAGCGAGCCAAGGTGAGG - Intergenic
1184449389 22:44574065-44574087 ACTGTGGGCTTCACAAGGGCAGG - Intergenic
949961019 3:9312556-9312578 CCAGTGACCTACCCAATGTCTGG - Intronic
953145020 3:40267034-40267056 CCTTTGGGTTCCCCAAGTTCCGG - Intergenic
953381178 3:42473961-42473983 GCTCTGGGTAACCCAAGGTCTGG - Intergenic
967489967 3:190079111-190079133 CAGGTGGGCCACCTAAGGTCAGG + Intronic
967983679 3:195080259-195080281 GCTGTGGGCATCCCCAGGTCAGG - Intronic
968581933 4:1399277-1399299 CCTGTGGCCAACCCAGGGTGGGG + Intergenic
968956742 4:3723337-3723359 ACTGGAGGCTCCCCAAGGTCGGG + Intergenic
969161262 4:5261004-5261026 ACTGTGGGCTGCCCAAGGAAGGG + Intronic
969244915 4:5925704-5925726 ACTGTGGGCCCCCCAAGGCCAGG - Intronic
970584445 4:17501740-17501762 CCTTTGCGCCAGCCAAGGTCAGG + Exonic
972999639 4:44930201-44930223 TCTGTGGGCTACATAAGGCCTGG - Intergenic
980983979 4:139677728-139677750 CGGGTGGATTACCCAAGGTCGGG - Intronic
981354962 4:143778284-143778306 CCCGTAGGGTACCCAAAGTCTGG - Intergenic
993070824 5:83161357-83161379 CCTGTGGATTACCTGAGGTCAGG - Intronic
996398452 5:123035883-123035905 GCTGTGGGCTACGCGAGGCCGGG - Intronic
996705013 5:126488936-126488958 CCTGTTGGTTGCCCTAGGTCAGG + Intronic
997885318 5:137624948-137624970 CCTTTGTGCTACCCCAGCTCAGG - Intronic
998159476 5:139805219-139805241 ACTGTGGGAAACCCAAGGGCAGG - Intronic
999916012 5:156261797-156261819 CCTAGGGGCTACACAGGGTCAGG - Intronic
1001539835 5:172530092-172530114 CCAGAGGGATACCCATGGTCAGG - Intergenic
1001954159 5:175837018-175837040 CCTTTGGGATACCCAAGTTAGGG - Intronic
1003523962 6:6883097-6883119 CCTGTTGGCTTCCCAAGGCTGGG - Intergenic
1004138218 6:12989600-12989622 CCTGTAGGATATCCAAAGTCCGG + Intronic
1004278016 6:14255183-14255205 GCTGTGGGTTACCTGAGGTCAGG + Intergenic
1005721674 6:28608400-28608422 CCCGTAGGGTACCCAAAGTCCGG - Intronic
1006107706 6:31726635-31726657 ACTGTGAGCTCCCCAACGTCAGG + Intronic
1006693871 6:35914202-35914224 CGTGTGGATCACCCAAGGTCGGG - Intronic
1007721748 6:43889298-43889320 CCTCAGGCCTACCCAAGGGCAGG + Intergenic
1009720833 6:67467243-67467265 CTTGTGGGCTAATCAGGGTCGGG - Intergenic
1013794862 6:113875817-113875839 CCTGTGTGCTTCTCAAGGGCAGG - Intergenic
1013926607 6:115480516-115480538 CAGTTAGGCTACCCAAGGTCAGG + Intergenic
1017870540 6:158482848-158482870 GCTGTGGAGTACCCAAGGACTGG + Intronic
1022513912 7:30963597-30963619 CCTGGGAGCTTCCCAAGGGCAGG + Intronic
1023345263 7:39265219-39265241 CCTGTGTGATCCCCCAGGTCTGG + Intronic
1023883065 7:44332282-44332304 CCGGTGGATCACCCAAGGTCAGG + Intronic
1026944094 7:74305369-74305391 CCTGAGGGCAACCCAACGACAGG - Intronic
1030123593 7:106134072-106134094 CCCTTGGGCTGCCCAAGGCCAGG - Intergenic
1031359823 7:120836075-120836097 CCTCTGGGATGCCCAAGTTCAGG - Intronic
1031643062 7:124189664-124189686 CCTGTGGGGTACAAAAGGCCAGG - Intergenic
1033355139 7:140593267-140593289 GCTGTGGGCTCCCCAAAGGCAGG - Intronic
1033947577 7:146740823-146740845 CCTGAGGGCTACCCAAAGCCTGG + Intronic
1034518545 7:151601114-151601136 CCTGTGGGTAACCCCAGGACAGG - Intronic
1034533999 7:151715581-151715603 CAGGTGGATTACCCAAGGTCAGG - Intronic
1035860186 8:3020077-3020099 GCTGTAGGCTACCCAGGGTCTGG + Intronic
1036614786 8:10379741-10379763 CCTGAGGGTTACCCTAGGCCTGG - Intronic
1043852658 8:85232541-85232563 CAAGTGGATTACCCAAGGTCAGG - Intronic
1044623713 8:94216307-94216329 CCTGTGGACCACCCAAGGCAAGG - Intronic
1049421580 8:142518956-142518978 CCTGTCTGCTGCCCAAGGTCGGG + Intronic
1050005924 9:1130387-1130409 CCTGTGCCCTACCCTAGATCTGG + Intergenic
1050303851 9:4286371-4286393 CCTGTGGGGTTCCCGATGTCCGG + Exonic
1053105772 9:35406541-35406563 CCTGTGATCTACCCAAAGGCAGG + Intergenic
1056593411 9:87984170-87984192 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1058793682 9:108476037-108476059 CCTGTGGGCTAGATAAGATCTGG + Intergenic
1059348897 9:113650674-113650696 CCTGTGGGCCACCCCAGGCTGGG - Intergenic
1060284142 9:122234065-122234087 ACTGTGGGCTCCTCAAGGGCAGG - Intergenic
1060400823 9:123348635-123348657 ACTGTGAGCTCCCCAAGGACGGG + Intergenic
1061074042 9:128330030-128330052 CCTGTCTGCTACACAAGGGCAGG - Intronic
1062035037 9:134379232-134379254 CCTGTGGGCTCCCTGAGGGCGGG + Intronic
1187653060 X:21432460-21432482 ACTGTGGGCTCCGCTAGGTCAGG + Intronic
1189366019 X:40389232-40389254 TCTGTGTGATTCCCAAGGTCAGG - Intergenic
1190556057 X:51637016-51637038 CCAGTAGGGTACCCAAAGTCTGG - Intergenic
1190878493 X:54476240-54476262 CCTGGGAGCTCCCCAAGGGCAGG - Intronic
1192478095 X:71460967-71460989 GCTGTGGGCTCCTCAAGGGCAGG - Intronic
1195295217 X:103469896-103469918 CCCGTAGGGTACCCAAAGTCCGG + Intergenic
1199716559 X:150511147-150511169 CTTATGGTTTACCCAAGGTCAGG - Intronic
1201346831 Y:12993896-12993918 CATGTAGGGTACCCAAAGTCTGG + Intergenic
1201932615 Y:19369072-19369094 CCGGTGGACCACCCAAGGTTGGG - Intergenic