ID: 1119421304

View in Genome Browser
Species Human (GRCh38)
Location 14:74509412-74509434
Sequence GGTGAGGTTCCTGCATTGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 142
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 135}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119421304_1119421308 2 Left 1119421304 14:74509412-74509434 CCAGGCAATGCAGGAACCTCACC 0: 1
1: 0
2: 1
3: 5
4: 135
Right 1119421308 14:74509437-74509459 GGCTTCCCTCTCTGAGCCCCTGG 0: 1
1: 0
2: 2
3: 48
4: 451
1119421304_1119421309 3 Left 1119421304 14:74509412-74509434 CCAGGCAATGCAGGAACCTCACC 0: 1
1: 0
2: 1
3: 5
4: 135
Right 1119421309 14:74509438-74509460 GCTTCCCTCTCTGAGCCCCTGGG 0: 1
1: 1
2: 4
3: 31
4: 334
1119421304_1119421310 4 Left 1119421304 14:74509412-74509434 CCAGGCAATGCAGGAACCTCACC 0: 1
1: 0
2: 1
3: 5
4: 135
Right 1119421310 14:74509439-74509461 CTTCCCTCTCTGAGCCCCTGGGG 0: 1
1: 1
2: 5
3: 64
4: 461

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119421304 Original CRISPR GGTGAGGTTCCTGCATTGCC TGG (reversed) Intronic
900423288 1:2564854-2564876 GGTGGGCTTCCTGCTGTGCCTGG - Intronic
902241918 1:15095187-15095209 CGTGAGGTTCCCGCATTGGTTGG - Intronic
902667361 1:17948857-17948879 GGAGAGGCCCCTGCAGTGCCTGG - Intergenic
903569289 1:24292493-24292515 GGTGAGGTCCCTGTCCTGCCAGG - Intergenic
905440953 1:37996442-37996464 GGTGGGGTTCCTTAATTGGCTGG - Intergenic
906483846 1:46219802-46219824 GGTGAGGCTGCTGCAATGACTGG - Exonic
907491060 1:54809048-54809070 TCTGAGGTTCTTGCAGTGCCTGG + Intronic
908214440 1:61936390-61936412 GGTGAGCTTAATGCATTGCTAGG - Intronic
915462335 1:156077472-156077494 GGTGTGGCTCCTGCTCTGCCCGG - Exonic
920173716 1:204087330-204087352 GGTCAGGTGCCTGCCTTCCCAGG + Intronic
921453341 1:215336583-215336605 AGTGAGGTTGCTGCACTGCATGG + Intergenic
1062971997 10:1655090-1655112 GGTGAGGTTCCAGCAGGGGCAGG + Intronic
1063104976 10:2985060-2985082 TGTGAGGGTCCTGGATTGCGTGG - Intergenic
1064031104 10:11883428-11883450 GGAGAGGTGACTGCATTTCCTGG - Intergenic
1064437541 10:15324329-15324351 GGGGAAGGACCTGCATTGCCTGG - Intronic
1066100273 10:32111393-32111415 GATGTGATTCCTGGATTGCCTGG + Intergenic
1067931791 10:50569366-50569388 TGTCAGGTTCCTCCATTCCCTGG - Intronic
1068967170 10:62924441-62924463 GGTGGGGTTCCTGCTTGTCCTGG + Intergenic
1071872968 10:89815411-89815433 GGTGTGTTTCCTGCATAGTCAGG + Intergenic
1072708778 10:97701910-97701932 TTTGAGGTTCCTCCATGGCCCGG + Intergenic
1073008118 10:100340026-100340048 GCTGAGGGGCCTGCAGTGCCTGG + Intergenic
1074523683 10:114246853-114246875 AGGGAGGTTCAGGCATTGCCAGG - Intronic
1075088268 10:119428554-119428576 GTTCAGGTTCCAGCCTTGCCAGG - Intronic
1077021008 11:417167-417189 GGGGAGGTTCCCGCGTCGCCCGG - Intronic
1079130299 11:17743454-17743476 GGTGAGGGCCCTGCCTGGCCAGG + Intronic
1079294547 11:19221362-19221384 GGTGAGTTGCTTGCATTTCCTGG + Intergenic
1080698217 11:34621437-34621459 TGTGAATTTCCTGCATTGTCTGG + Intronic
1084455377 11:69265186-69265208 GCTGAGGCTCCTGCAGGGCCTGG - Intergenic
1089711005 11:120314719-120314741 GGGGAGGTTCCTGAATTGCATGG + Intronic
1092257950 12:6937278-6937300 GGCGAGGTTCCTCGATAGCCCGG - Exonic
1092525807 12:9309681-9309703 GGTGATTTTGCTGCATGGCCAGG + Intergenic
1092541483 12:9422135-9422157 GGTGATTTTGCTGCATGGCCAGG - Intergenic
1092985495 12:13841445-13841467 GATGAGGTTCCGGGATTGCGGGG - Intronic
1094511560 12:31100368-31100390 GGTGATTTTGCTGCATGGCCAGG + Intronic
1098611427 12:72463209-72463231 GGTGATGCTCCTGAATTGCTAGG + Intronic
1102760032 12:115377006-115377028 GGTGATGTTACGCCATTGCCGGG + Intergenic
1103335135 12:120183753-120183775 AGGGAGGGTCCTGCATTACCAGG - Intronic
1104618658 12:130292688-130292710 CGTTAGGTTCCTGCATTCACTGG - Intergenic
1107046474 13:35998378-35998400 TGTGAGGTTTCTGCATTCGCAGG - Intronic
1108273977 13:48789480-48789502 ACTGAGGTTCCTGCCCTGCCAGG - Intergenic
1108481585 13:50877842-50877864 TGTGAGGTTCATCCATTGCAAGG - Intergenic
1112676808 13:101711076-101711098 GATGAGGTTAGTGCAGTGCCGGG + Exonic
1119421304 14:74509412-74509434 GGTGAGGTTCCTGCATTGCCTGG - Intronic
1120698496 14:87671336-87671358 GCTAAGGTTCCTGGTTTGCCTGG - Intergenic
1121456668 14:94042946-94042968 GGTGAGGTGCCTGGATTGGAGGG - Intronic
1121833000 14:97067912-97067934 GGTGAGGCAGCTGCATGGCCAGG - Intergenic
1123002910 14:105305880-105305902 AGTGAGGGTCCTGCCTTGCAGGG - Exonic
1125889257 15:43253484-43253506 GGTGAGGTCCCTGGCGTGCCCGG - Exonic
1129055551 15:72817459-72817481 GGTGAGGGTCGTGCAAGGCCTGG - Intergenic
1129491526 15:75930955-75930977 GTTGAGGTCCCTGGACTGCCAGG + Intronic
1131613100 15:93985781-93985803 GGTGGTGTTCCTGCTCTGCCGGG - Intergenic
1133268005 16:4596159-4596181 GCTGAAGTTCCTTCATTCCCCGG + Intronic
1133413554 16:5588510-5588532 GATGAAGTGCCTGGATTGCCTGG - Intergenic
1135414452 16:22258109-22258131 GGTGAGGTGCCTGGAGAGCCAGG - Intronic
1140528280 16:75642161-75642183 GGTGAAGTTCCAACAGTGCCAGG + Intronic
1140562341 16:75997844-75997866 GTTAAGGGTCCAGCATTGCCAGG - Intergenic
1141251627 16:82363994-82364016 GGAGTGGTTCCTGCATTCTCTGG + Intergenic
1141267471 16:82509875-82509897 GGTGAGGACCCAGCCTTGCCCGG - Intergenic
1142026525 16:87817162-87817184 GGGTAACTTCCTGCATTGCCAGG - Intergenic
1142055919 16:87995891-87995913 GCTGGGGTTCCTGCGGTGCCCGG + Intronic
1142483259 17:231310-231332 GGTGGGCTGCCTGCTTTGCCTGG + Intronic
1142839854 17:2619563-2619585 GGAGATGTTCCTGAATTACCTGG + Intronic
1142985130 17:3690809-3690831 GGTGTGGTTCCTGCATTATATGG - Intronic
1144395962 17:14843520-14843542 GGTGAGGTTGGAGCATTGTCAGG - Intergenic
1147910623 17:43853860-43853882 GCTGAGGCCCCTCCATTGCCAGG + Exonic
1152242310 17:79167045-79167067 GGTGACGTGCCCGCCTTGCCGGG - Intronic
1152418077 17:80175848-80175870 GAGGAGGTCCCTGCAGTGCCCGG - Intronic
1153055245 18:939389-939411 GGTGAGGTTCTTGCATCACAGGG + Intergenic
1156381169 18:36562786-36562808 GGTGAGTCTCCTGTATGGCCAGG - Intronic
1156919037 18:42496874-42496896 GGTGAGATTGCTGCATTGCAGGG + Intergenic
1162030344 19:7914537-7914559 GGGGAGGTTTCTGCATTGAGGGG + Intergenic
1162746248 19:12800337-12800359 GGTGAGGACCCTGCTGTGCCAGG - Intronic
1164792628 19:31001337-31001359 GCTGAGCTGCCTGCCTTGCCTGG + Intergenic
1165793684 19:38506749-38506771 GAAGTGGTTCCTGCAGTGCCCGG - Intronic
1167631723 19:50629873-50629895 GGTGAGGATCCTGCAGGCCCTGG - Exonic
932144378 2:69305576-69305598 GGTGAGGGTCCTGAATGGGCAGG + Intergenic
933759598 2:85664706-85664728 GGTGAGGTTCCTGCTGAGGCAGG - Intronic
936083849 2:109453194-109453216 GGAGAGGTTCCTGCATAGGCTGG - Intronic
940009295 2:149038134-149038156 GGTAAGGTTCCTGCCTCTCCTGG + Intronic
946336228 2:219038477-219038499 GGTGTGGTTCCTGCTGTTCCTGG + Exonic
948505355 2:238424153-238424175 GGTGAGGATCCTGCTGGGCCTGG - Intergenic
949031093 2:241797876-241797898 GGTGAGCTTCCTGCTTGGACTGG - Intronic
1171054639 20:21894548-21894570 AGTGAGATTCCTGGATTGCAAGG + Intergenic
1174158811 20:48535721-48535743 GCTGTGGTTCCTGCAAAGCCTGG - Intergenic
1174419043 20:50387518-50387540 GGTGAAGTTCCTGCTTTCCTGGG - Intergenic
1175105383 20:56611186-56611208 GGTGGGGTTCCTGCTGTGCGGGG + Intergenic
1184893757 22:47395038-47395060 GGCCTGGTTCCTGCCTTGCCAGG + Intergenic
1185180111 22:49355033-49355055 GGAGAGGGTCATGCATTTCCTGG + Intergenic
1185330156 22:50248809-50248831 GGTGAGGGCCTTGCCTTGCCAGG - Exonic
1185373260 22:50470501-50470523 GGAGAGGTGCCTGCTTGGCCTGG - Intronic
949439513 3:4065743-4065765 GCTGATGTTCCTGCCTTGCTGGG - Intronic
950093362 3:10312982-10313004 AGTGAGGCTCCTGCCTGGCCAGG - Intronic
951087152 3:18526305-18526327 GCTCAGTATCCTGCATTGCCTGG + Intergenic
953252766 3:41261685-41261707 TCTGCGGTTCCTGCTTTGCCTGG - Intronic
956290520 3:67655074-67655096 GGTGAGGTTCCTGCAGCCCAGGG + Intergenic
959402654 3:105921959-105921981 GGTGTGGTGCCTCCCTTGCCTGG + Intergenic
961017759 3:123480696-123480718 GCTGAGGTTTCTGCAGGGCCAGG + Intergenic
966553456 3:181230822-181230844 GGTGTGGCTCCTGCAGTCCCCGG + Intergenic
968817797 4:2830767-2830789 GGTGGGCTTCCTGCCTTGCCTGG + Intronic
968880124 4:3294272-3294294 GGTGGGGCTGCTGCCTTGCCTGG - Intronic
970322271 4:14886430-14886452 GGTGAGGGTTCTGCAATGCTGGG + Intergenic
982844295 4:160230392-160230414 AGGGAGGCTCCTGCATTTCCAGG + Intergenic
984417411 4:179478919-179478941 GGTGAGTTTCCTGCAATGAGTGG + Intergenic
994739036 5:103595247-103595269 GGAGAGTTTCCTGAATTACCTGG - Intergenic
997411897 5:133696987-133697009 GCTGAGGTAGCTGCATTGTCTGG - Intergenic
999757555 5:154676225-154676247 GGTGAGCTTCCTCCAGAGCCAGG - Intergenic
1000343283 5:160294183-160294205 GGTGAGCCTCCTGCCTTGCTGGG - Intronic
1000351092 5:160353530-160353552 GGTGAGGTGCCTCCATTTGCAGG - Intronic
1001673173 5:173491190-173491212 GGAGATGATCCTGCATTGTCTGG + Intergenic
1002447287 5:179297390-179297412 TCTCAGGTTTCTGCATTGCCAGG - Intronic
1003507070 6:6748873-6748895 CGTGAGGTCCCTCCAATGCCCGG + Intergenic
1003819275 6:9877855-9877877 GGTGTGGTGCCTCCATTGGCTGG - Intronic
1003989575 6:11472284-11472306 GGTGATTCTCCTGCACTGCCAGG - Intergenic
1010189006 6:73175530-73175552 GGTGAGCTTGCTGCCTTCCCAGG + Intronic
1012227632 6:96723148-96723170 GGTGAGGCTCCATCATTGTCAGG + Intergenic
1012432190 6:99175535-99175557 GGTGAGTTTTCTTCATAGCCAGG - Intergenic
1018134546 6:160767131-160767153 GGCGAGGGTCCTGCCTTTCCCGG + Intergenic
1019289031 7:241013-241035 GGTGAGGTTTCTGCACTGATTGG + Intronic
1019390607 7:784485-784507 GGGGAGGTTGCTGCAGTGGCTGG - Intronic
1019893513 7:3965643-3965665 GGTGAGGTTCCTGTGCTTCCAGG + Intronic
1020080843 7:5284870-5284892 GCCGAGGTTTCTGCCTTGCCCGG - Intronic
1022517873 7:30987321-30987343 GGTGAGGTTCCTGGCCTGCTGGG + Intronic
1024607457 7:51034156-51034178 GCAGAGGTACCAGCATTGCCTGG - Intronic
1025198075 7:56947297-56947319 GCCGAGGTTTCTGCCTTGCCCGG + Intergenic
1025673874 7:63629640-63629662 GCCGAGGTTTCTGCCTTGCCCGG - Intergenic
1032618684 7:133503732-133503754 GGAAATGTTCCTGCATTTCCAGG + Intronic
1033756230 7:144399842-144399864 GGTGTGGTTCCAGAATCGCCGGG - Exonic
1034673702 7:152876531-152876553 GGTGGGGTTTCTGCATTTCTGGG - Intergenic
1035616970 8:1009127-1009149 GGTGGTGTTCCTGCAATGCTTGG + Intergenic
1036734933 8:11304635-11304657 GGCCAGCTTCCTGCATTGCTAGG - Intronic
1040766012 8:50912353-50912375 GGTGAGGTTTCTGCCTTGTTTGG - Intergenic
1041859591 8:62497832-62497854 CCTGAGTTTCCAGCATTGCCAGG + Intronic
1045730407 8:105232361-105232383 GGTTAGGATCCAGCATTGCTAGG + Intronic
1046537773 8:115537755-115537777 ATTGAGGTTCCTGCAAAGCCTGG - Intronic
1049797845 8:144504693-144504715 GGTGAGGCTCCTGCACTGCCCGG + Exonic
1062064946 9:134521740-134521762 GGTGCTGTTTCTGCATTGGCTGG - Intergenic
1062468204 9:136690801-136690823 GCTGAGGTCCCGGCATAGCCTGG - Intergenic
1186692392 X:11992476-11992498 GGTGAGATGCCTGCATTCCCTGG + Intergenic
1187975771 X:24703428-24703450 GGTGGAGTTGCTGCTTTGCCTGG + Intronic
1192234724 X:69288590-69288612 GTTGAGGTTTCTTCACTGCCAGG + Intergenic
1195366576 X:104132311-104132333 GGTGAGGTTACTTCAGTTCCTGG + Intronic
1199742009 X:150744842-150744864 GTGGAGATTCCTGGATTGCCTGG - Intronic