ID: 1119423504

View in Genome Browser
Species Human (GRCh38)
Location 14:74522007-74522029
Sequence GTGTCTGAGGGACCCCTGCA AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 183}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119423504_1119423518 23 Left 1119423504 14:74522007-74522029 CCTTGCAGGGGTCCCTCAGACAC 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1119423518 14:74522053-74522075 GGCAGGGAGGGAGGTCAGGGGGG 0: 1
1: 1
2: 35
3: 482
4: 5377
1119423504_1119423507 2 Left 1119423504 14:74522007-74522029 CCTTGCAGGGGTCCCTCAGACAC 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1119423507 14:74522032-74522054 GTTGTCATCTGACCAGAAGAAGG 0: 1
1: 0
2: 3
3: 6
4: 130
1119423504_1119423519 30 Left 1119423504 14:74522007-74522029 CCTTGCAGGGGTCCCTCAGACAC 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1119423519 14:74522060-74522082 AGGGAGGTCAGGGGGGCCAGCGG 0: 1
1: 0
2: 4
3: 83
4: 708
1119423504_1119423513 14 Left 1119423504 14:74522007-74522029 CCTTGCAGGGGTCCCTCAGACAC 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1119423513 14:74522044-74522066 CCAGAAGAAGGCAGGGAGGGAGG 0: 1
1: 2
2: 26
3: 270
4: 2353
1119423504_1119423514 19 Left 1119423504 14:74522007-74522029 CCTTGCAGGGGTCCCTCAGACAC 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1119423514 14:74522049-74522071 AGAAGGCAGGGAGGGAGGTCAGG 0: 1
1: 0
2: 29
3: 864
4: 8775
1119423504_1119423515 20 Left 1119423504 14:74522007-74522029 CCTTGCAGGGGTCCCTCAGACAC 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1119423515 14:74522050-74522072 GAAGGCAGGGAGGGAGGTCAGGG 0: 1
1: 0
2: 27
3: 490
4: 2607
1119423504_1119423516 21 Left 1119423504 14:74522007-74522029 CCTTGCAGGGGTCCCTCAGACAC 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1119423516 14:74522051-74522073 AAGGCAGGGAGGGAGGTCAGGGG 0: 1
1: 0
2: 9
3: 233
4: 1803
1119423504_1119423508 6 Left 1119423504 14:74522007-74522029 CCTTGCAGGGGTCCCTCAGACAC 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1119423508 14:74522036-74522058 TCATCTGACCAGAAGAAGGCAGG 0: 1
1: 0
2: 1
3: 19
4: 169
1119423504_1119423509 7 Left 1119423504 14:74522007-74522029 CCTTGCAGGGGTCCCTCAGACAC 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1119423509 14:74522037-74522059 CATCTGACCAGAAGAAGGCAGGG 0: 1
1: 0
2: 2
3: 22
4: 214
1119423504_1119423517 22 Left 1119423504 14:74522007-74522029 CCTTGCAGGGGTCCCTCAGACAC 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1119423517 14:74522052-74522074 AGGCAGGGAGGGAGGTCAGGGGG 0: 2
1: 4
2: 46
3: 1086
4: 11485
1119423504_1119423510 10 Left 1119423504 14:74522007-74522029 CCTTGCAGGGGTCCCTCAGACAC 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1119423510 14:74522040-74522062 CTGACCAGAAGAAGGCAGGGAGG 0: 1
1: 0
2: 3
3: 30
4: 379
1119423504_1119423511 11 Left 1119423504 14:74522007-74522029 CCTTGCAGGGGTCCCTCAGACAC 0: 1
1: 0
2: 0
3: 19
4: 183
Right 1119423511 14:74522041-74522063 TGACCAGAAGAAGGCAGGGAGGG 0: 1
1: 0
2: 2
3: 60
4: 664

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119423504 Original CRISPR GTGTCTGAGGGACCCCTGCA AGG (reversed) Exonic
901688506 1:10957958-10957980 GTGTGCCAGGCACCCCTGCAAGG - Intronic
902117299 1:14132120-14132142 ATTTCTGAGGGACCCCGGTAGGG - Intergenic
902303125 1:15517087-15517109 GTGTCTGGTGGACCATTGCATGG - Intronic
903672688 1:25045956-25045978 TTGATTGAGGGACCCCTGCATGG - Intergenic
905289510 1:36911873-36911895 GTGTCTGGGGGAGGCCCGCATGG - Intronic
910156517 1:84225331-84225353 GAGTCTGAGGGCCTCCTGCCTGG - Intronic
910892283 1:92030262-92030284 GTGCCTGAGCGACCCCTCCTTGG + Exonic
912611055 1:111044524-111044546 GTGGCTGTGGGACTACTGCAGGG - Intergenic
912761097 1:112368184-112368206 GTGTCTGAGGGACACCAAGAAGG - Intergenic
915008063 1:152658865-152658887 CTGTGTGACTGACCCCTGCATGG - Intergenic
915267859 1:154731685-154731707 GAATCTGAGGGATCACTGCAAGG + Intronic
916051885 1:161042174-161042196 GTGTCTGAGGGGCAGCTGGATGG - Exonic
916169058 1:161987003-161987025 GTGTGAGACGGAACCCTGCAGGG - Intronic
918072429 1:181142661-181142683 GTGTCTGCGAGCCGCCTGCAGGG - Intergenic
920294200 1:204945943-204945965 GTGGGTGAGGGGTCCCTGCAAGG + Intronic
1063208485 10:3857191-3857213 GCCTCTGAGGGTCTCCTGCAAGG + Intergenic
1065593308 10:27287571-27287593 GTGCATGAGGGACCTCTGCAGGG + Intergenic
1065657066 10:27962716-27962738 GTGCATGAGGGACCTCTGCAGGG - Intronic
1066111808 10:32204045-32204067 GTGCCTGAGAGAGCCTTGCATGG + Intergenic
1066617257 10:37307920-37307942 CCTTCTCAGGGACCCCTGCAGGG - Intronic
1069628072 10:69880495-69880517 GTCTCCGGGGGACCCCTGCGGGG - Exonic
1069707106 10:70465846-70465868 ATGTCTGTGGGACCCTGGCAGGG - Intergenic
1069866235 10:71504911-71504933 GTGTGTGAGCGTCTCCTGCAGGG + Intronic
1070742064 10:78909752-78909774 GTCACTGAGGGACCCTGGCAAGG - Intergenic
1070949721 10:80421205-80421227 GTGTCTGAGGAATCACTTCAAGG + Intronic
1072290663 10:93961623-93961645 TTGTCTGAGGGAGCCCTGGAGGG - Intergenic
1072850431 10:98884814-98884836 CTGTCAGAGGGATCTCTGCAAGG - Intronic
1076018143 10:127045667-127045689 GTGTCTGCGGCTCCCCTGCGTGG + Intronic
1076052507 10:127346894-127346916 CTGTCTGAGGGGCCTCTCCAGGG + Intronic
1076253248 10:128999535-128999557 GTGGCTCAGGGACCCGTCCATGG - Intergenic
1076693599 10:132236439-132236461 GTGTGTGTGGGGCCCGTGCACGG - Intronic
1077367231 11:2166140-2166162 GTGTCCCAGAGACCCCTGGAGGG - Intronic
1077405385 11:2380195-2380217 GGGGCTGCGGGAACCCTGCAGGG + Intronic
1077918949 11:6629192-6629214 GTATCTGAGGGAGGCCTGGAGGG + Intronic
1079251766 11:18792148-18792170 CTGCCAGAGGGACCCCGGCAGGG + Intronic
1083225264 11:61280955-61280977 GGGTCTGAGGTTCCCCAGCAGGG + Exonic
1085534992 11:77212317-77212339 GTCTATGTGGGACCCCTGCCAGG - Intronic
1086220935 11:84442314-84442336 GTGTATAAAGGACCCCTTCAAGG - Intronic
1088511661 11:110581897-110581919 GTGTCTGAGGGACCAGTACAAGG + Intronic
1089283599 11:117391618-117391640 GTCTCTGAGGGACAGCTGCAAGG + Intronic
1093794735 12:23297916-23297938 GTATCTGAGGGAACCATTCAAGG - Intergenic
1094157120 12:27348930-27348952 ATGTCTGAGGGGCCCCAGTAGGG + Intronic
1095918571 12:47505848-47505870 GGGTCTGAGGGACAACAGCACGG - Intergenic
1095922650 12:47546243-47546265 GTGCTTGAGTGACCCCTGCTTGG + Intergenic
1096633633 12:52945217-52945239 CTGTGGGAGGGCCCCCTGCATGG + Intronic
1101221599 12:102647026-102647048 GTGTCTGTGGAACACCTGAATGG + Intergenic
1102196614 12:111029976-111029998 CTGTCTGGTGGACACCTGCAGGG - Intergenic
1102226098 12:111229366-111229388 ATGTCTGAAGGCCTCCTGCAGGG - Intronic
1103902625 12:124311337-124311359 GTGTCTGTGGCACACCTGCCAGG - Intronic
1105593174 13:21812580-21812602 CTGGCTGGGGGAGCCCTGCAGGG + Intergenic
1105638284 13:22237126-22237148 CTGTCTGAGAGACCCTTCCAGGG - Intergenic
1105810370 13:23990156-23990178 GTGGCTGAGGGAATCCAGCAGGG - Intronic
1106344341 13:28861092-28861114 GTCTCTGTGGGACCCTTACAGGG + Intronic
1106388077 13:29307570-29307592 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1107910438 13:45100620-45100642 GTGCCTGAGGGGCCCTTGCAGGG + Intergenic
1111194925 13:84861959-84861981 GTGTCTGATGGACCACTGGTGGG + Intergenic
1113484681 13:110645444-110645466 ACGTCTGAGGGTCCCCTGCCAGG - Intronic
1116498532 14:45592101-45592123 GTGTGTGAAGGACCTCTTCAAGG + Intergenic
1116960724 14:50965620-50965642 GACACTGAGGGACCACTGCAGGG - Intergenic
1117715971 14:58581586-58581608 GGATGTGAGGGACCCCTTCAGGG - Intergenic
1119423504 14:74522007-74522029 GTGTCTGAGGGACCCCTGCAAGG - Exonic
1121849536 14:97207467-97207489 GTCTCTGGGGGACCCATGCGAGG + Intergenic
1122152661 14:99733160-99733182 GTGTCTCAGGGAACCCAGGAAGG + Intergenic
1124373800 15:29117866-29117888 GTCTCTGTGGGAGCCCTGCCCGG - Exonic
1129034170 15:72639746-72639768 GACTCTCAGGGACCCATGCATGG - Intergenic
1129215712 15:74097470-74097492 GACTCTCAGGGACCCATGCATGG + Intergenic
1129732845 15:77941798-77941820 GACTCTCAGGGACCCATGCATGG + Intergenic
1130891477 15:88137350-88137372 GTGTCTGAGGGATGCCTCCCTGG + Intronic
1131144719 15:90003178-90003200 GGGTCTGAGGGAGGCCTGCCGGG + Intronic
1131590902 15:93747152-93747174 GTGACTGAAGGCCCCCTGCAGGG - Intergenic
1133230981 16:4366376-4366398 GTCTCTGAGGGGCCCCGGGAGGG - Intronic
1134249909 16:12567056-12567078 CTGTTTCAGGGAACCCTGCAGGG + Intronic
1136133168 16:28237441-28237463 ATGTCTCAGGCACACCTGCATGG + Intergenic
1137671293 16:50281130-50281152 GTGTCAGAGGAAGCCCTGCAGGG - Intronic
1138456639 16:57124952-57124974 GTCCTTGAGGGACCGCTGCAGGG - Intronic
1138689464 16:58753930-58753952 GGGTCTCAGGCACCCCTGCTTGG - Intergenic
1139421190 16:66850543-66850565 GTGACTGGGGGCCCCCTGGAAGG + Exonic
1139580809 16:67872781-67872803 GGGTCTGAGGGACCTTAGCATGG + Intergenic
1145274649 17:21422341-21422363 GTGTGGGAGAGACGCCTGCAGGG - Intergenic
1145311957 17:21705791-21705813 TTTTCTGAAGGTCCCCTGCATGG + Intergenic
1145312499 17:21708239-21708261 GTGTGGGAGAGACGCCTGCAGGG - Intergenic
1145993081 17:29090796-29090818 GTGGCTCAGGTACCCCTGCCAGG - Exonic
1146820082 17:35977851-35977873 CTGTCTGAGGGAACCCAGCCAGG - Intronic
1150546235 17:66160136-66160158 GAATCTGAGGGACCTCTTCAAGG + Intronic
1150631005 17:66880422-66880444 GAGTCTGGGGAACCCCTGCAGGG + Intronic
1152288854 17:79427392-79427414 GTCTCTGAGGGGCGACTGCAGGG + Intronic
1152356298 17:79809316-79809338 GAGTCTGAGCTGCCCCTGCAAGG - Intergenic
1152987036 18:330424-330446 GTGCCTGGTGGAGCCCTGCAGGG + Intronic
1154307540 18:13241544-13241566 GTGCCTGAGGGACGGATGCAGGG + Intronic
1155091885 18:22520126-22520148 GTGGCAGAGGGACCCTTGCTTGG + Intergenic
1158517057 18:58139308-58139330 GTATCTGAGGGTCTCCTGTATGG - Intronic
1160877878 19:1305767-1305789 GTGGCTGTTGGATCCCTGCAAGG - Intergenic
1161367804 19:3891012-3891034 GTGTCAGACAGAGCCCTGCATGG + Intronic
1162886327 19:13700162-13700184 GTGACTGAGGGTCACCTCCAGGG - Intergenic
1163550736 19:17965361-17965383 GTGGCTCAGGGACTCCTGCAAGG + Intronic
1166766480 19:45254305-45254327 ATGGCTGAGGGACCCCTGCGAGG - Intronic
1168494938 19:56840280-56840302 GGGTCTGAGGGGCTGCTGCAGGG - Intronic
926773412 2:16398268-16398290 GTGGCTCAGGGATCCCTGGATGG + Intergenic
927037061 2:19188922-19188944 GACTCTGTGGGCCCCCTGCATGG - Intergenic
931386075 2:61798618-61798640 GTGTCTGAGGGTCCACTTCCTGG - Intergenic
931695356 2:64866717-64866739 GTTTCTGAAGGACCCAGGCAGGG + Intergenic
932750575 2:74369060-74369082 GGGTCTGAGGGAGCCCTGCCTGG - Intronic
937999293 2:127719692-127719714 GTGTCTCAGGGACCTCTGATGGG - Exonic
943769999 2:191705729-191705751 GTGCCTGAAGGAGCCCTCCATGG + Intergenic
944075195 2:195721888-195721910 GTGTCTGAGTGAATCCTTCAAGG - Intronic
947808220 2:232982963-232982985 GTGTCCGAGGAAGACCTGCATGG + Intronic
948132144 2:235608603-235608625 GTGTCTGGGGGACGCATCCAGGG + Intronic
949046265 2:241873894-241873916 GGGCGTGAGGGGCCCCTGCAGGG - Intergenic
1168924166 20:1565992-1566014 GAGTCTCAGGGAACCCTGTATGG - Intronic
1170169317 20:13393465-13393487 GTGTCAGAGGGCCCCCTCAAGGG + Intronic
1173776697 20:45714478-45714500 GTGACTGAGGGCTCCCAGCAGGG - Intergenic
1174616904 20:51842589-51842611 GGGTCCGAGAGACTCCTGCAAGG + Intergenic
1175981738 20:62742180-62742202 GTGTCTGTGGGACCACTGTGGGG - Intronic
1176099745 20:63359497-63359519 GTGACTGAGGTCGCCCTGCAAGG - Intronic
1176247514 20:64104508-64104530 GTGTCTGACGGTCCTCTCCATGG - Intergenic
1176247549 20:64104645-64104667 GTGTCTGACGGTCCTCTCCATGG - Intergenic
1176386163 21:6139410-6139432 CTGGCTGAGGGTCACCTGCAGGG + Intergenic
1177802727 21:25843812-25843834 GAACCTGACGGACCCCTGCAAGG - Intergenic
1177858162 21:26422509-26422531 GTGTCAGACAGACCCCTTCAAGG - Intergenic
1179737310 21:43398842-43398864 CTGGCTGAGGGTCACCTGCAGGG - Intergenic
1180149762 21:45941442-45941464 GTGTGTGAGCCAGCCCTGCATGG - Intronic
1180854218 22:19036161-19036183 GGGTTTGATGGACGCCTGCAAGG + Intergenic
1181093143 22:20487909-20487931 GGAGCTGAGGGCCCCCTGCAGGG - Intronic
1181542254 22:23579860-23579882 GTGTCTGTGGCTCCCCTCCAGGG + Intronic
1181727279 22:24820264-24820286 GTGTCTGAGGAACCTGGGCAGGG + Intronic
1184586296 22:45450337-45450359 GGGTCTGAGGGACACCAGCAGGG - Intergenic
1185065722 22:48630892-48630914 GTGTCCCAGGGGCACCTGCATGG + Intronic
1185241766 22:49750690-49750712 GTGAATGAGGGGCTCCTGCAGGG - Intergenic
1185275456 22:49948649-49948671 GTGTCTCAGGCACTCCTTCAGGG + Intergenic
1185315912 22:50179034-50179056 GTGTCAGAGGGGCCACAGCAGGG - Exonic
950014084 3:9743981-9744003 GTGTAGGAGGGACCTCTGCCTGG - Intronic
954652362 3:52172877-52172899 GTGTCTGAGCTCCACCTGCAGGG - Intergenic
954912789 3:54122695-54122717 GCGTCGGAGGGAGCCCAGCATGG + Exonic
961508231 3:127385651-127385673 GGGGCTGAGGGTCCCCTTCATGG + Intergenic
967292887 3:187938644-187938666 ATGTTTAAGGCACCCCTGCAAGG + Intergenic
968266705 3:197368530-197368552 GTGTATGGGAGATCCCTGCAAGG + Intergenic
968954392 4:3710836-3710858 GTGTCTGAAGGCCCCCCGCAAGG - Intergenic
969620980 4:8278694-8278716 GAGCCTGGGGCACCCCTGCAGGG - Intronic
969706779 4:8796903-8796925 CAGTCTGGGGGACCCCTGCTTGG - Intergenic
972011268 4:34185210-34185232 GGATCTGAGGGACCCCTCCTAGG - Intergenic
973553811 4:52061570-52061592 GTGGCTGAAGGATCCCTGCTTGG + Intronic
973760494 4:54110223-54110245 GTGTCCGAGGGCACCCAGCAGGG - Intronic
976430428 4:84957627-84957649 ATGTCTCAGGGATCCCTGAAAGG + Intronic
979057609 4:116016008-116016030 GTGTCTGAGATACTCCTGCAAGG + Intergenic
980680435 4:136152731-136152753 GTGGCTGTGGCACCCCTGCTAGG - Intergenic
985862787 5:2487516-2487538 GTGGCATAGGGACTCCTGCAGGG + Intergenic
986004617 5:3657544-3657566 GTGTCAGGGAGAGCCCTGCAGGG + Intergenic
987576390 5:19733813-19733835 GTGTCTCAGGCACCACTGCCTGG + Intronic
992351323 5:75932157-75932179 GTGTCTGAGGCCAGCCTGCAGGG - Intergenic
994066179 5:95545312-95545334 GTGACTGATGGAGCCCAGCAGGG - Intronic
995184200 5:109254453-109254475 GTGTCTCAGGTCCCCATGCAGGG + Intergenic
997370497 5:133356759-133356781 GGGCCTGAGGGATCCCTGCGAGG - Intronic
999813128 5:155147418-155147440 GTTTCTTAGTGCCCCCTGCAGGG + Intergenic
1002395106 5:178946484-178946506 GGGTAAGTGGGACCCCTGCAAGG + Exonic
1004326058 6:14674888-14674910 GTTTCCTCGGGACCCCTGCAGGG + Intergenic
1005809808 6:29506883-29506905 CTGTCTGCAGCACCCCTGCACGG - Intergenic
1010294626 6:74182082-74182104 GTGACTGTGGGACCCTGGCATGG - Intergenic
1013616060 6:111844601-111844623 GAGTCTGAGGCACCTCTGAAAGG - Intronic
1015570918 6:134620672-134620694 GAATCTGTGGGACACCTGCATGG - Intergenic
1019416112 7:927140-927162 GTCTCTGAGGGGACTCTGCAGGG + Intronic
1019429229 7:991040-991062 GGGCCCGAGGGTCCCCTGCAGGG - Intergenic
1019772922 7:2895013-2895035 CTGACTGAGGGTCCCCAGCATGG - Intergenic
1022624435 7:32020088-32020110 GAGCCTGAGGGATCCCGGCATGG - Intronic
1023021445 7:36015211-36015233 GTGTCAGAGGAAACCCTACAGGG - Intergenic
1025020835 7:55477892-55477914 GTAGCTGAGGGACCCCGGCCAGG + Intronic
1025824378 7:64998663-64998685 GTGTCTGAAATACTCCTGCAAGG - Intronic
1026825605 7:73579380-73579402 GTGTCTGAGGATTCCCTGGATGG + Intergenic
1027738991 7:81976439-81976461 GTGTGTGAAGGACCTCTTCAGGG - Intronic
1028572879 7:92311307-92311329 GTGGCTGAGTGACACATGCAAGG - Intronic
1029465233 7:100720951-100720973 GTCGCTGAGGGACCCCGGCCAGG + Exonic
1032502416 7:132409908-132409930 GAGTCTGGGGGCCCCCTGCCGGG - Intronic
1034493205 7:151405290-151405312 CAGCCTGAGGGAGCCCTGCAGGG - Intronic
1035260414 7:157658448-157658470 GCTTCTGAGGGATCACTGCAGGG + Intronic
1035363154 7:158327702-158327724 GGTCCTGAGGGACCCCAGCAGGG - Intronic
1037938045 8:22928292-22928314 GTGTAGGAGGGACTGCTGCAGGG + Intronic
1040096807 8:43453331-43453353 GTGTCTCAGGGACCAGTACAAGG - Intergenic
1040897689 8:52385838-52385860 GAGTCTGAGGGACCCCTGTCAGG + Intronic
1044117211 8:88350209-88350231 GTGACTAAAGGACCCCTGCAGGG + Intergenic
1045017309 8:98010672-98010694 GTGTCTCTGGGGCCCCTCCAAGG - Intronic
1046681418 8:117174570-117174592 CTGTCTGAAGGACCACTGAATGG + Intronic
1048279075 8:133091385-133091407 GTGTCAGAGGGTCCTCTGGATGG - Intronic
1049021004 8:139957693-139957715 GTGGCTGAGGGTTTCCTGCATGG - Intronic
1049781264 8:144430022-144430044 GTGTCAGAGGAGCCCCTGCCAGG + Intronic
1051419349 9:16874459-16874481 GTGTGTGAGTGTGCCCTGCAGGG + Intergenic
1055575666 9:77658380-77658402 GTGTCTGAGTCACCCCTTGATGG + Intergenic
1057140206 9:92722199-92722221 GTCTCAGAGGGACCCCTGACAGG - Intronic
1057275772 9:93675358-93675380 GTGGCTGAGGGACACCTGCTGGG + Intronic
1058207400 9:102125987-102126009 GTATCTGAAGGACCTCTTCAAGG - Intergenic
1058968312 9:110057305-110057327 GTAGCTGTGGGACCCCTGGATGG - Intronic
1061509562 9:131052325-131052347 GTGTGGGTGGGCCCCCTGCAGGG + Intronic
1061934422 9:133849468-133849490 GTGGCTGAGGGACCCCCTCCTGG + Intronic
1185760183 X:2684561-2684583 GTGTCTGTGAGACTCCTCCATGG + Intergenic
1186501118 X:10051431-10051453 GTCTCAGAGGGACCCTTGCTGGG + Intronic
1190125825 X:47704628-47704650 GAGTCTGAGAGATCCCTTCATGG + Intergenic
1190305660 X:49080092-49080114 CTGTCTGAGGGAACCCGGAAGGG + Intronic
1190380725 X:49837359-49837381 GTGGCTGGGGGAAGCCTGCATGG + Intergenic
1190622111 X:52297735-52297757 GTGTGTGATGGACCCCTACCTGG - Intergenic
1191111309 X:56804795-56804817 CTGTATGAAGGACCCATGCATGG - Intergenic
1193505379 X:82336303-82336325 GTGACTGAGAGACAGCTGCATGG - Intergenic
1193959990 X:87914062-87914084 GTGTCTGGTAGACCCATGCAGGG - Intergenic
1200335836 X:155350531-155350553 GGGTCTCAGGGACTCCTCCAGGG + Intergenic
1200350633 X:155490695-155490717 GGGTCTCAGGGACTCCTCCAGGG - Exonic
1201421886 Y:13808423-13808445 GTCTCTGAAGGACCTCTTCAAGG - Intergenic