ID: 1119424572

View in Genome Browser
Species Human (GRCh38)
Location 14:74527384-74527406
Sequence CAGCGTGAGCTCAGGGAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 378
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 345}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119424560_1119424572 15 Left 1119424560 14:74527346-74527368 CCTGGCCAGCCTGAGAGTCACCT 0: 1
1: 0
2: 0
3: 19
4: 252
Right 1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 30
4: 345
1119424567_1119424572 -5 Left 1119424567 14:74527366-74527388 CCTGGAAGGGAAAGGTAACAGCG 0: 1
1: 0
2: 0
3: 21
4: 561
Right 1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 30
4: 345
1119424565_1119424572 6 Left 1119424565 14:74527355-74527377 CCTGAGAGTCACCTGGAAGGGAA 0: 1
1: 0
2: 1
3: 24
4: 278
Right 1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 30
4: 345
1119424562_1119424572 10 Left 1119424562 14:74527351-74527373 CCAGCCTGAGAGTCACCTGGAAG 0: 1
1: 0
2: 3
3: 29
4: 313
Right 1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG 0: 1
1: 0
2: 2
3: 30
4: 345

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119424572 Original CRISPR CAGCGTGAGCTCAGGGAGGA GGG Intronic
900159428 1:1216474-1216496 CAGTGGGAGCTCAGGGAAGCCGG - Intergenic
900670632 1:3851997-3852019 CAGCGTGTGATCAGGGAGTATGG + Intronic
901401257 1:9016590-9016612 CAGAGTGAGACCAGGAAGGAAGG + Intronic
901773933 1:11546143-11546165 CAGTGACAGCTCAGGGAGGAGGG - Intergenic
903773776 1:25780331-25780353 CAGAGGGAGCTGAGGAAGGAGGG - Intronic
903925367 1:26827392-26827414 CAGGGTGGGGTCAGGGAGAATGG - Intronic
905227235 1:36487219-36487241 CAGGGTGGGTTCAGGGAAGAAGG - Intergenic
905873096 1:41416146-41416168 GGGCGGGAGCTCAGGGAGGTTGG + Intergenic
906196778 1:43934660-43934682 CAGTGGGAGCTCAGGAAGGCTGG + Intronic
906436243 1:45799079-45799101 AATCTTGAGCTCAGGGGGGAGGG + Intronic
906800700 1:48734555-48734577 AAGAGTGAGGTCAGGGAGGTGGG - Intronic
908671967 1:66557969-66557991 GAGCATGAGCTCTGCGAGGATGG + Intronic
912554190 1:110504271-110504293 CAGGGGGAGGTCAGGGAGGCTGG + Intergenic
912867230 1:113268458-113268480 CAGAGTTAGCTAAGTGAGGATGG - Intergenic
913064753 1:115240347-115240369 CACAGTGAGCACAGAGAGGAAGG - Intergenic
913074831 1:115333124-115333146 CTAAGTGAGCCCAGGGAGGATGG - Intronic
915444891 1:155968987-155969009 CAGAGTGAGGACAGGGAGCAAGG + Intronic
919925234 1:202188685-202188707 CAGCCTGGGCCCAGGGAGGGAGG - Intergenic
920762947 1:208803423-208803445 CAGCCTGACATCAGGGAGGTGGG + Intergenic
922578138 1:226677040-226677062 TAGCCTGGGCTCTGGGAGGAGGG - Intronic
923342801 1:233021994-233022016 CAGGGTTAGGCCAGGGAGGATGG + Intronic
1062781227 10:210432-210454 CAGCCTCAGTTCAGGTAGGATGG + Intronic
1062841929 10:679132-679154 GAGCATGGGCGCAGGGAGGATGG - Intronic
1062841993 10:679320-679342 GAGCATGGGCGCAGGGAGGATGG - Intronic
1063114889 10:3066786-3066808 CAGCCTGAGGTCGGGAAGGACGG - Intronic
1063536763 10:6891230-6891252 CGGCGTGAGGGCAGGCAGGAGGG - Intergenic
1064358316 10:14639843-14639865 CAGTGTTAGCTGAAGGAGGAAGG - Intronic
1067154092 10:43760473-43760495 CAGCCTGAGCTCAGGGAGTGGGG - Intergenic
1067850784 10:49752388-49752410 GAGAGTGAGCCCAGGGAGGCAGG + Intronic
1068696292 10:59971266-59971288 AAACGTGAGTTCAGAGAGGAAGG - Intergenic
1072825073 10:98598588-98598610 AAGCCTGAGCTCATGGAAGATGG + Intronic
1073563584 10:104517142-104517164 CAGCGGGAGCTCAGGGGGACAGG + Intergenic
1073886951 10:108050318-108050340 CAGTGTGAGCTCATCAAGGAAGG + Intergenic
1074438278 10:113453008-113453030 GAGAGTCAGCTGAGGGAGGAAGG - Intergenic
1075482952 10:122798043-122798065 CAGCCTGAGGCCATGGAGGAGGG - Intergenic
1075779459 10:125007517-125007539 CAGGTAGATCTCAGGGAGGATGG + Intronic
1075897925 10:126013973-126013995 CATCTTGAGCGCAGTGAGGAAGG + Exonic
1076075619 10:127531678-127531700 CAGAGAGAGCTCAGGGAGATCGG - Intergenic
1076427659 10:130379200-130379222 CAGTGTGAGCTGAGGAGGGAAGG - Intergenic
1076583613 10:131531339-131531361 CATGCTGAGCTGAGGGAGGAGGG + Intergenic
1076859401 10:133133549-133133571 CAGCGTGTGCCCAGGGAGGCAGG + Intergenic
1077164174 11:1127654-1127676 TAGCGTGGGCTCAGGGAGGCAGG - Intergenic
1077198130 11:1291660-1291682 CAGCGGGGGGTCAGCGAGGACGG - Intronic
1077336795 11:2008888-2008910 CACCGTGAGCTCAGGCCAGAGGG - Intergenic
1077793111 11:5462355-5462377 CTGTGTGAACTCAGGGAAGAGGG + Intronic
1078025891 11:7695389-7695411 CAGGGTGAACTCAGGGTTGAGGG + Intronic
1078524098 11:12087313-12087335 AAGAATGAGCTCAGGTAGGATGG + Intergenic
1079891201 11:26055348-26055370 CAGCCTAAGCTCAGGAATGAAGG - Intergenic
1080314784 11:30936503-30936525 CTGCATGAGCTTAGGAAGGAAGG - Intronic
1081100627 11:38997269-38997291 CAGCCTGAGCACTGGGAGGATGG - Intergenic
1083224430 11:61275888-61275910 CACCTTCAGCTCAGGCAGGATGG - Intronic
1083250660 11:61464466-61464488 CTTTGGGAGCTCAGGGAGGAAGG - Intronic
1083934283 11:65862276-65862298 CAGGGTGAGCACAGGGATCAGGG + Exonic
1084153203 11:67300783-67300805 CAGCCTGGGCCCAGGGAGGAGGG + Intronic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1084973158 11:72782034-72782056 CAGAGTGGGCTCTGCGAGGAAGG + Intronic
1086444289 11:86857919-86857941 CAGGGAGAGCCCAGTGAGGACGG + Intronic
1088798238 11:113282751-113282773 TCGCGTGAGCTCAGGGAGGTGGG - Intergenic
1089396253 11:118137863-118137885 CACGGAGAGCTCAGGGAGGAAGG - Intronic
1089579440 11:119472268-119472290 CAGCATGAAGACAGGGAGGATGG - Intergenic
1089639630 11:119839219-119839241 CACCATGAGCTCAGGGAAGTGGG + Intergenic
1090248991 11:125237983-125238005 GGACGTGAGGTCAGGGAGGAAGG - Intronic
1090331039 11:125932482-125932504 CCGCCTGAGCCCAGGGAGGCAGG + Intergenic
1202819779 11_KI270721v1_random:64070-64092 CACCGTGAGCTCAGGCCAGAGGG - Intergenic
1091672433 12:2462051-2462073 GGGGGTGAGCTTAGGGAGGAAGG - Intronic
1091765304 12:3116510-3116532 CTGCGTGACCTCAGGACGGAGGG - Intronic
1092791103 12:12071701-12071723 GACAGGGAGCTCAGGGAGGAGGG - Intronic
1094443624 12:30506556-30506578 CAGCCTGTGCACTGGGAGGATGG + Intergenic
1096245070 12:49980109-49980131 TAGCTTGAGCTGAGGGGGGACGG + Intronic
1096510220 12:52123735-52123757 CAGCTTTGGCTGAGGGAGGATGG - Intergenic
1096526561 12:52213437-52213459 CAGCTTGAACTCAGGGAGGCGGG - Intergenic
1096536062 12:52275583-52275605 AAGCCTGAACTCAGGCAGGAAGG - Intronic
1097176638 12:57147212-57147234 CAGGGGGAGGGCAGGGAGGAAGG - Intronic
1097320486 12:58220473-58220495 CAGCTGGAGCTTAGAGAGGAGGG - Intergenic
1099902835 12:88734031-88734053 CAGAGTGAACTCATAGAGGAGGG + Intergenic
1100930748 12:99607091-99607113 CAGAGTTAGGCCAGGGAGGATGG + Intronic
1102901981 12:116646112-116646134 CACCGTGAGGACAGAGAGGAGGG + Intergenic
1104906105 12:132214280-132214302 CAGCAGGAGCCCAGGGATGAAGG + Intronic
1106100338 13:26689854-26689876 CAGACTGAGCTCTGGGAGGCAGG + Intergenic
1107015365 13:35704663-35704685 CTGTGCCAGCTCAGGGAGGAGGG - Intergenic
1107822332 13:44297014-44297036 CAGTGTGAGCTTAAGAAGGAGGG - Intergenic
1108275418 13:48804466-48804488 CAGCATGTGCTCAGTGAGGGAGG + Intergenic
1108886208 13:55185451-55185473 CAACTAGAGCTAAGGGAGGAAGG + Intergenic
1111485627 13:88895554-88895576 CAGAGTGAGCACTGGGAGCAGGG - Intergenic
1113768023 13:112892987-112893009 CAGACTGAGGTCCGGGAGGAGGG - Intergenic
1113793709 13:113044604-113044626 CAGAGTGAGCCCACGGAAGAGGG + Intronic
1117079101 14:52133083-52133105 GAGGCTGAGCTGAGGGAGGAGGG + Intergenic
1118632495 14:67718514-67718536 CAGTGTTAGCCCTGGGAGGATGG + Intronic
1119199038 14:72739590-72739612 GGGCATGAGCCCAGGGAGGATGG + Intronic
1119424572 14:74527384-74527406 CAGCGTGAGCTCAGGGAGGAGGG + Intronic
1121401980 14:93688030-93688052 CAGTGTGAGCTCAGTGGGAAGGG - Intronic
1122143612 14:99676262-99676284 CAGCACCTGCTCAGGGAGGATGG + Exonic
1122672411 14:103382871-103382893 CAGAGTTAGCTGTGGGAGGATGG - Intergenic
1122742406 14:103879950-103879972 CCGTGTGAGGTCAGGGAGGGTGG - Intergenic
1122861979 14:104586806-104586828 AAGAGGCAGCTCAGGGAGGAGGG + Intronic
1122914593 14:104852426-104852448 CAGGGTGAGCCTAGGAAGGAAGG - Intergenic
1123804084 15:23853627-23853649 AAGCGTGACCTCAGGTATGAAGG + Intergenic
1124114385 15:26827646-26827668 CAGTGTGAGCTGGGGCAGGAGGG - Intronic
1125796233 15:42406062-42406084 CAGCAGAAGCTCAGGAAGGAGGG - Intronic
1125972282 15:43921646-43921668 CAACATGGGCTTAGGGAGGAGGG + Intronic
1127329286 15:57922974-57922996 CAGGATCAGCTCAGGGAGGAGGG + Intergenic
1127829475 15:62737723-62737745 CAGAGTGAGGTTTGGGAGGATGG + Intronic
1128304068 15:66586643-66586665 CAGCGTGGACTCAGGCAGGCTGG + Intronic
1128306188 15:66600401-66600423 CAGCTCGAGCTCAGGAGGGAGGG - Intronic
1128710314 15:69866766-69866788 CAGCGTGAGATCAGACAGGAGGG - Intergenic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129756910 15:78104247-78104269 CAGGGTCAGGGCAGGGAGGAGGG - Exonic
1130074100 15:80673990-80674012 CTGCGGGACCTCCGGGAGGAGGG - Intergenic
1130956570 15:88631014-88631036 CAGGCACAGCTCAGGGAGGAGGG + Exonic
1132584943 16:702027-702049 CAGAGTGAGCCTAGGGAGCACGG + Intronic
1133503942 16:6391812-6391834 CAGTGTGAGCTCTTCGAGGATGG - Intronic
1134090122 16:11387063-11387085 CAGGGGGCTCTCAGGGAGGAGGG + Intronic
1135992799 16:27228213-27228235 CTGGGTGAGCACAGGAAGGAAGG + Intronic
1137597542 16:49734743-49734765 AAGCATGAGCTCTGGGAGGTAGG - Intronic
1139927817 16:70501058-70501080 CAGGGTGACCTCAGTCAGGATGG + Exonic
1141792639 16:86246970-86246992 GAGCTTGAGCTCCGTGAGGAAGG - Intergenic
1142012759 16:87725154-87725176 CAGCGTCACCTCTGGGCGGAGGG + Intronic
1142537746 17:631489-631511 GAGCGTGAGCTCGGCAAGGATGG + Intronic
1144390672 17:14790739-14790761 CTGTTAGAGCTCAGGGAGGAAGG + Intergenic
1145305434 17:21671716-21671738 CAGCTTGAGCCAAGGCAGGATGG - Intergenic
1146479702 17:33195172-33195194 CTGCCTGTGCTCAGGGAGGTTGG - Intronic
1146507317 17:33416598-33416620 CAGTGGCAGCTGAGGGAGGATGG + Intronic
1147948114 17:44091935-44091957 CAGTGGGAGCTCAGGGTAGAGGG - Intronic
1148786161 17:50147259-50147281 CAGCTTGGCCTCAGGGAGGTGGG - Intronic
1149040952 17:52187565-52187587 CAGTGTGAGCTCAGGGACATGGG + Intergenic
1150143917 17:62752327-62752349 CAGCAAGTGCTCTGGGAGGAAGG + Intronic
1150783857 17:68146819-68146841 CAGCATTACCTCAGGGATGAGGG + Intergenic
1151561274 17:74871128-74871150 CAGCGTGAGCCGAGGCAGGTGGG - Intronic
1152042122 17:77910141-77910163 CAGCGTGAGGACAGGGAGAGGGG - Intergenic
1152755900 17:82086904-82086926 CATCGTGAGCTCCGGCCGGAGGG + Intronic
1154293019 18:13127157-13127179 CAGCTGGAGCTCAGGGAGGACGG - Intergenic
1154437485 18:14357889-14357911 CAGCGTGGGATCAGGCAGCAGGG - Intergenic
1154978534 18:21482778-21482800 CAGCGAAAGCACAGGGAGCATGG + Intronic
1156972290 18:43170920-43170942 CAGCCTGAGCACTGGGAGAATGG + Intergenic
1157474486 18:48012552-48012574 AGGAATGAGCTCAGGGAGGAAGG - Intergenic
1157616105 18:48988708-48988730 CAGCCTGAGCTGGGGGAGGAGGG + Intergenic
1157816550 18:50733592-50733614 CAGCCTCAGCTCAAGTAGGATGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1160489731 18:79326579-79326601 CCATGTGAGCTCAGGGAGGGAGG - Intronic
1160509304 18:79444424-79444446 CAGCGTGGGCTCGGGGTGGGTGG - Intronic
1160538632 18:79608714-79608736 CAGGCTGAGCTGCGGGAGGATGG + Intergenic
1161526560 19:4759731-4759753 GAGCGGGAGCTGAGGGAGGGAGG + Intergenic
1161556219 19:4944292-4944314 CAGCGTGAGCCCTGGCAGGCGGG - Intronic
1161660735 19:5544308-5544330 TAGGGTGAGCTCAGTGAGGCGGG + Intergenic
1162856268 19:13470757-13470779 CAGCAAGAGATCAGAGAGGAGGG + Intronic
1163632166 19:18423081-18423103 CAGAGTGGGCTGAGGGAGGCTGG + Intronic
1163762693 19:19146046-19146068 GGCCGTGAGCTCAGCGAGGAAGG + Intronic
1163884094 19:19950707-19950729 CAGAGTGAGATATGGGAGGAAGG - Intergenic
1163894541 19:20046492-20046514 CAGCCTGAGTCCAGGGAGGACGG + Intergenic
1165064117 19:33219230-33219252 CAGCGAAGGCTCAGGGAAGAGGG - Intronic
1165939690 19:39408838-39408860 CAGCGTGAGGTCAGGGGAGTGGG - Exonic
1166259228 19:41626405-41626427 GAGCGTGAGCTCTGTGAGGGCGG + Intronic
1166411931 19:42561241-42561263 GAGCGTGAGCTCCGTGAGGGTGG + Intergenic
1167077418 19:47257892-47257914 CAGGATGAGCACAGGGAGGTGGG + Intronic
1167314621 19:48756414-48756436 CACCTGGAGATCAGGGAGGATGG + Exonic
1167785201 19:51630276-51630298 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1167787300 19:51646700-51646722 GTGAGTGAGCTGAGGGAGGAGGG - Intronic
1168283991 19:55321411-55321433 CTGGGTGAGCTTAGGGAAGAAGG + Intronic
1168284287 19:55322688-55322710 CTGGGTGAGCTCAGGGAAGAAGG + Exonic
925185370 2:1843083-1843105 CAGGGAGAGCCCAGCGAGGATGG - Intronic
925404714 2:3598637-3598659 CCGCGTGAGCACAGGGGAGAAGG + Intronic
925838212 2:7966086-7966108 CAGTGTGAGCTCAAGGAGGTTGG - Intergenic
925891657 2:8439524-8439546 GAGGGTGAGCCCCGGGAGGAAGG + Intergenic
925983860 2:9199118-9199140 CAGTGGGAGCTCTGGGAGCAAGG - Intergenic
926095185 2:10076772-10076794 CAGCGTGTGCTTAGGAAGCATGG - Intronic
926787909 2:16536672-16536694 CAGCATGTGCTAAGGCAGGAAGG + Intergenic
927495847 2:23551182-23551204 CAGCGTAAACTGAGGGAAGAAGG - Intronic
931188468 2:59976550-59976572 TAAAGTGAGCTCAGGGAAGAAGG - Intergenic
931292270 2:60883098-60883120 CAGCGTGAGCAAAGGCAGGGAGG + Intronic
934487090 2:94725525-94725547 CAGCGTGGGATCAGGCAGCAGGG - Intergenic
934488347 2:94738365-94738387 CAGCGTGGGATCAGGCAGCAGGG + Intergenic
934590585 2:95546660-95546682 CAGGGACAGCCCAGGGAGGACGG - Intergenic
936089346 2:109490900-109490922 CAGCTTGGGCTCGGGGCGGATGG - Exonic
936706766 2:115084713-115084735 GAGCCTGAGCTCTCGGAGGAAGG - Intronic
937911319 2:127077009-127077031 CAGTGTGAGATCAGCTAGGAGGG - Intronic
941078896 2:161037304-161037326 CAGATTGAGCTCAAGGAAGAAGG + Intergenic
943927424 2:193803071-193803093 CAGGGTGAGCGCAGGCAAGATGG + Intergenic
944107688 2:196097134-196097156 CAGCATGAACTCAGGTATGATGG - Intergenic
945317930 2:208391070-208391092 CAGCTTGGGCTTAGGGAGGGAGG + Intronic
945670359 2:212795011-212795033 CAGGGTGAGCTAAGGAAGGGGGG + Intergenic
946152733 2:217787344-217787366 CGGTGGGAGCGCAGGGAGGACGG + Intergenic
946152793 2:217787570-217787592 CAGCGTGAGTTCTGGGTGGGCGG - Intergenic
947871481 2:233441215-233441237 CAGGGGGAGCCCAGGAAGGAAGG + Intronic
948290153 2:236818541-236818563 CAGCATGAGCTCCCTGAGGAGGG - Intergenic
948355284 2:237372732-237372754 TAGGGTGGGCTCAGAGAGGATGG + Intronic
1169522017 20:6384486-6384508 CAGGATGAGCTCATGGAAGAGGG - Intergenic
1170226367 20:13995579-13995601 GAGCGCGGGCTGAGGGAGGAGGG + Exonic
1170938122 20:20827198-20827220 CAGTGGGAACTCAGGGAAGAGGG + Intergenic
1171958652 20:31477790-31477812 GAGCTGGATCTCAGGGAGGACGG - Intronic
1172689350 20:36779553-36779575 CAGGGTGAGCCCAGTGAGAAGGG + Exonic
1172827046 20:37798008-37798030 CAGAGTGAACGCAGGAAGGAGGG - Intronic
1174318061 20:49718184-49718206 CAGAGTGAGGGCAGGGAGGAAGG - Intergenic
1174514417 20:51080643-51080665 CAGCGTGAACTTTGAGAGGATGG - Intergenic
1174544132 20:51312587-51312609 CTGCCTGAGCACTGGGAGGATGG - Intergenic
1174926620 20:54767313-54767335 CAGAGTGAGGGCAGGGAGGCAGG - Intergenic
1175523564 20:59618442-59618464 CAGAGTGAGACCAGGGAAGAGGG + Intronic
1175845686 20:62057604-62057626 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845705 20:62057678-62057700 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845724 20:62057752-62057774 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845743 20:62057826-62057848 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845760 20:62057899-62057921 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845778 20:62057973-62057995 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845796 20:62058046-62058068 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845813 20:62058119-62058141 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845831 20:62058193-62058215 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845849 20:62058266-62058288 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845867 20:62058340-62058362 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845885 20:62058414-62058436 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845902 20:62058487-62058509 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845919 20:62058560-62058582 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845937 20:62058634-62058656 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845956 20:62058708-62058730 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845974 20:62058781-62058803 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175845991 20:62058854-62058876 CAGCAAGACCTCAGGAAGGACGG + Intronic
1175846008 20:62058927-62058949 CAGCAAGACCTCAGGAAGGACGG + Intronic
1176839566 21:13827751-13827773 CAGCGTGGGATCAGGCAGCAGGG + Intergenic
1177991997 21:28047953-28047975 CATTGTGAGCTCAAGGAAGAAGG - Intergenic
1179409366 21:41150235-41150257 CTGCGTGAGCACAGGGGGGCTGG + Intergenic
1179640614 21:42745228-42745250 CGGGGTGGGCGCAGGGAGGAAGG + Intronic
1180109406 21:45641137-45641159 CACCCCGAGCTCAGGGAGGCAGG + Intergenic
1181165250 22:20979735-20979757 CAGCGGGAGCTCAGTCGGGAAGG + Intronic
1181415004 22:22753073-22753095 CAAGGTGAGCACTGGGAGGACGG + Intronic
1181484736 22:23223601-23223623 CAGGGGGTACTCAGGGAGGAGGG + Intronic
1181495356 22:23284490-23284512 CTGGGTGAACCCAGGGAGGAGGG - Intronic
1183467099 22:37985296-37985318 CAGGGTGAGCCCAGTGTGGAAGG - Intronic
1183694731 22:39415305-39415327 TAGCGTGAGCATGGGGAGGAGGG + Intronic
1184046472 22:41975607-41975629 GAGAGTGAGATCAGGGAGGCAGG - Intergenic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184342518 22:43893733-43893755 CAGTGTGAGTTCAGGAAGGGAGG + Intergenic
1184969667 22:48006885-48006907 CAGCGTGTGCTTAGGGAAAATGG + Intergenic
949123155 3:412212-412234 CAGCGTGAGACAAGGGAGCAGGG - Intergenic
950857001 3:16115151-16115173 TGGCGTGAGCTGAGGCAGGAGGG + Intergenic
950872542 3:16242191-16242213 CAGCCCAGGCTCAGGGAGGAGGG + Intergenic
952342179 3:32455839-32455861 CAGAGTCTGCTCAGTGAGGAAGG + Intronic
953636947 3:44671916-44671938 CAGCATGAGCTCTGGGAGAAAGG + Intergenic
954692843 3:52404920-52404942 CAGCAGGAGCTTAGGGAGGCAGG - Intronic
954698943 3:52441779-52441801 CAGGGTGAGAACAGGGAGGGTGG - Intronic
955393238 3:58536358-58536380 CAGGTTGAGGTCAGGAAGGAAGG - Intronic
956111980 3:65878976-65878998 CAGCAGGAGCTCAGGCAGCAGGG - Intronic
956986653 3:74709057-74709079 CATAGTGAGATCAGGAAGGAAGG - Intergenic
957043679 3:75357358-75357380 CAGGGTCAGCCCAGCGAGGACGG + Intergenic
959343762 3:105165627-105165649 CAGCATGAACACAGGGAGTAAGG - Intergenic
961022612 3:123521654-123521676 CAGAGTCACCACAGGGAGGAGGG + Intronic
962975108 3:140439285-140439307 CAGTGAGAGGCCAGGGAGGAGGG + Intronic
964148687 3:153497763-153497785 CAGCGAGAGCTGAGGGGAGAGGG - Intronic
968624191 4:1619142-1619164 GTGCTGGAGCTCAGGGAGGATGG - Intronic
968915984 4:3497270-3497292 GAGCCCCAGCTCAGGGAGGAGGG + Intronic
969411260 4:7029885-7029907 CTGGGTGAGCTCAGGAAGGCAGG + Intronic
969582498 4:8073299-8073321 CAGCCAGACCTCAGCGAGGACGG - Intronic
970789529 4:19840249-19840271 CTGCGTCATCTCAGGGTGGAAGG - Intergenic
973216058 4:47670667-47670689 CAGCATGGGCACAGGGAGGCAGG + Intronic
976215808 4:82714493-82714515 AAGCATGAGCTCATGAAGGAGGG + Intronic
976474236 4:85464320-85464342 AAGCGTGTGGTCAGGCAGGAAGG + Intergenic
976517609 4:85986931-85986953 CAGTGGGAGCTCAGGGAGGAAGG + Intronic
983509085 4:168588193-168588215 CACTGTGAGCCCTGGGAGGATGG + Intronic
984756945 4:183333250-183333272 AAGCGTGAGGTGAGGGAGGAGGG + Intergenic
985626485 5:991588-991610 CATGGTGAGCTCAGGGAGGTGGG + Intergenic
985711504 5:1432185-1432207 CAGCGGCAGCTCAGGGTGGGAGG - Intronic
986192352 5:5509286-5509308 CAGAGTGAACTGAGGTAGGAGGG + Intergenic
986296904 5:6446823-6446845 CAGCGTGAGCTAAAAGAGTAGGG - Intergenic
988737587 5:34038267-34038289 TAAGGTGAGCACAGGGAGGATGG + Intronic
989109179 5:37890451-37890473 CAGAGTGAGCTCAGTGTGGCAGG + Intergenic
991676607 5:69094461-69094483 CAGCCTGCGCGCAGGGAGGCAGG - Intronic
992881439 5:81114279-81114301 CAGCCTGAGCTCACGGGTGAGGG - Intronic
993898975 5:93571620-93571642 TTATGTGAGCTCAGGGAGGAAGG + Intergenic
994178997 5:96743474-96743496 CAGCCTGAGCTGATGGAGGTGGG - Intronic
996677017 5:126188054-126188076 CAGCCTGCGCTCTGGGAGGTTGG + Intergenic
997234803 5:132266579-132266601 CAGAGTGAGCCCAGGGCAGAGGG + Intronic
997398374 5:133582385-133582407 CAGTGAGAGCTGAGAGAGGAGGG + Intronic
998466124 5:142345472-142345494 CTGCATGAGCTCAGGTAGGCAGG + Intergenic
998853269 5:146371232-146371254 TAGCATGACCTCAGGTAGGAAGG - Intergenic
999147500 5:149405984-149406006 CAGCATGAGCTCTGGGAAGAAGG + Intergenic
999438300 5:151581443-151581465 GAGGGTTAGCTCAGGGAGGTAGG - Intergenic
1000266943 5:159647021-159647043 CAGCTTGAGCCCTGGCAGGAAGG - Intergenic
1001757377 5:174180930-174180952 CAGCTGGAACTCAGGAAGGAGGG - Intronic
1002097632 5:176840809-176840831 CAGCGTGGGCTCATGGGGGCAGG - Intronic
1002953334 6:1837844-1837866 CATCTACAGCTCAGGGAGGAAGG + Intronic
1003271458 6:4611385-4611407 CAGCATGAGCACACAGAGGAGGG - Intergenic
1003311865 6:4975649-4975671 CAGGGGGAGTCCAGGGAGGAAGG - Intergenic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1006151476 6:31992383-31992405 CAGCTGGAGCTCAGCGTGGACGG + Exonic
1006157777 6:32025121-32025143 CAGCTGGAGCTCAGCGTGGACGG + Exonic
1006397952 6:33799251-33799273 CAGCGTGGGTTGAGGGAGGGCGG - Intronic
1006901755 6:37507345-37507367 CATAGTTAGCCCAGGGAGGAAGG + Intergenic
1006902241 6:37510727-37510749 CATGGTGTGCACAGGGAGGAGGG + Intergenic
1007663604 6:43501437-43501459 CAGAGTGGGCTCAGGAAGGAAGG - Intronic
1007725829 6:43915071-43915093 CAGCCTGGGCACATGGAGGAGGG + Intergenic
1007983625 6:46185305-46185327 CAGGCAGAGCTGAGGGAGGAAGG - Intergenic
1009902534 6:69825839-69825861 CAGCTTTACCTCAAGGAGGATGG + Intergenic
1009943455 6:70316717-70316739 TAGCAAGAGCTCAGGGATGAGGG + Intergenic
1010813685 6:80329615-80329637 CAGCACCAGCACAGGGAGGAGGG - Intronic
1012288956 6:97427014-97427036 CAGAGGGAGCTTAGAGAGGAGGG + Intergenic
1012945797 6:105464244-105464266 GAGAGTGAGGTCAGAGAGGAAGG + Intergenic
1013731684 6:113175653-113175675 CAATGTGAGGTCAGAGAGGATGG + Intergenic
1015190603 6:130467816-130467838 CAGAGTGAGCAGAGGGAGGGAGG - Intergenic
1017248429 6:152253182-152253204 TAGGGTGATCTCAGGGAAGATGG - Intronic
1017795470 6:157840268-157840290 CTGAGGGAGCTCAGGGAAGAGGG + Intronic
1017971343 6:159315168-159315190 CACCCTGAGCTCAGGGAGGCAGG - Intergenic
1018559741 6:165089238-165089260 CACCGTGAGGTCAGGGAAGCAGG - Intergenic
1018918750 6:168156068-168156090 CAGCGTGTGCACCGGGGGGATGG - Intergenic
1019070519 6:169341223-169341245 CAGCCAGAGCCCAGTGAGGAGGG + Intergenic
1019157462 6:170048864-170048886 CAGGCTCAGCTCAGGGTGGAGGG + Intergenic
1019182841 6:170202630-170202652 CACTGTAAGCTCAGGGAGGGCGG - Intergenic
1019270194 7:142766-142788 CAGGGTGAGCTCCGGTGGGAGGG - Intergenic
1019341059 7:509160-509182 CAGCGCAACCCCAGGGAGGAAGG + Intronic
1023788887 7:43736412-43736434 CAGCGTGAGATAAGGAAGGAAGG + Intergenic
1023863808 7:44229463-44229485 CATCCTGAGCTCAGTGAGGAGGG - Exonic
1023990301 7:45124646-45124668 CAGGGGAAGCTCAGGGAGAAAGG + Intergenic
1024085063 7:45885681-45885703 AAGTGAGACCTCAGGGAGGATGG + Intergenic
1024132473 7:46368691-46368713 CAGCATGAGCTCAGGAAAGCAGG + Intergenic
1024242785 7:47448236-47448258 GAGGGGGAGCACAGGGAGGAGGG + Intronic
1025283382 7:57644113-57644135 CAGCTTGAGCCAAGGCAGGATGG - Intergenic
1027194470 7:76020205-76020227 CAGGATGAGCTTAGGGAAGAAGG + Intronic
1029506045 7:100964840-100964862 CAGAGTGAGCCCAGGCTGGAGGG + Exonic
1032329259 7:130962498-130962520 CAGCCTGTGCACTGGGAGGAGGG - Intergenic
1032738763 7:134717619-134717641 GAGCCTGAGCACAGGGAGGCGGG - Intergenic
1034347917 7:150398278-150398300 CAGCGTGGGTTGAGGGAGGAGGG + Exonic
1034479621 7:151309256-151309278 CAGCGGGTGCTCAGGGTGAAAGG + Intergenic
1034531593 7:151699279-151699301 CAGCCTGACCGCAGGGAGGGAGG - Intronic
1034936910 7:155205763-155205785 CAGAGTCAGCTCACGGAAGATGG - Intergenic
1035121988 7:156576564-156576586 CAGAGTGAGCCCAGGGGGAAGGG - Intergenic
1035383253 7:158453607-158453629 CTGGGTGAGCTCAGGAAAGAGGG + Intronic
1035679733 8:1479098-1479120 CAGGGTGAGCCCAGGCAGGGGGG + Intergenic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1037821593 8:22137726-22137748 CAGTGGGAGCACAGGCAGGAGGG - Intergenic
1039435675 8:37557652-37557674 CTGCGGGAGATCAGGGAGAAGGG - Intergenic
1039581394 8:38669708-38669730 GAGCATGGGCTCAGGAAGGATGG - Intergenic
1039802422 8:40970846-40970868 CAGCCTGAGCACTGGGAGGACGG - Intergenic
1040554988 8:48470187-48470209 CAGCGGGAGGCCAGGGAGCAAGG + Intergenic
1045775506 8:105797742-105797764 CAGCCTGAGCTGAGGTATGAAGG - Intronic
1047408551 8:124605548-124605570 CAGCGAGAGGGCAGGGAGGGAGG - Intronic
1047408558 8:124605571-124605593 CAGCGAGAGGGCAGGGAGGGAGG - Intronic
1047408565 8:124605594-124605616 CAGCGCGAGGGCAGGGAGGGAGG - Intronic
1047408572 8:124605617-124605639 CAGCGCGAGGGCAGGGAGGGAGG - Intronic
1049182587 8:141230631-141230653 CAGCGTGCGCTCGGGCAGCAAGG - Intronic
1049334575 8:142076395-142076417 CAGCATGAGCTCAGGAGGGAGGG - Intergenic
1049392975 8:142381504-142381526 CAGGGTGGGCTCAGGGACGGTGG + Intronic
1051031864 9:12690502-12690524 TAGAGTAAGCTCAGTGAGGAAGG + Intronic
1051612858 9:18978453-18978475 GAGTTTGAGCTCAGGCAGGAAGG - Intronic
1052220022 9:26009263-26009285 CTGCGAGAGCTCAGAGAAGAGGG - Intergenic
1052288640 9:26817748-26817770 CAGCTTGAGCTCAGGCATTAGGG + Intergenic
1052792829 9:32892207-32892229 CAGCGGTAGCCCAGGAAGGAGGG - Intergenic
1053152845 9:35753941-35753963 CAGAGAGGGCACAGGGAGGATGG - Exonic
1053669440 9:40345999-40346021 CAGCGTGGGATCAGGCAGCAGGG - Intergenic
1053670701 9:40358805-40358827 CAGCGTGGGATCAGGCAGCAGGG + Intergenic
1053919238 9:42972241-42972263 CAGCGTGGGATCAGGCAGCAGGG - Intergenic
1053920504 9:42985178-42985200 CAGCGTGGGATCAGGCAGCAGGG + Intergenic
1054261885 9:62875127-62875149 CAGCTTGAACTAAGGGAGGGAGG - Intergenic
1054380572 9:64486019-64486041 CAGCGTGGGATCAGGCAGCAGGG - Intergenic
1054381823 9:64498868-64498890 CAGCGTGGGATCAGGCAGCAGGG + Intergenic
1054513912 9:66017495-66017517 CAGCGTGGGATCAGGCAGCAGGG - Intergenic
1054515174 9:66030292-66030314 CAGCGTGGGATCAGGCAGCAGGG + Intergenic
1055968005 9:81884041-81884063 CAGCCTGAGCCAAGTGAGGAAGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1057198962 9:93130324-93130346 CATCCTCAGCTCAGGCAGGAGGG + Intronic
1057519846 9:95751972-95751994 GAGCCTGAGCTCCGGGAGGGAGG + Intergenic
1058744334 9:107975140-107975162 CCACGTGAGGTCAGTGAGGAAGG - Intergenic
1060468688 9:123930003-123930025 CAGCCTGAGGGAAGGGAGGAAGG - Exonic
1061506074 9:131032454-131032476 GAGCGAGAGCGAAGGGAGGAAGG - Intronic
1061804680 9:133131351-133131373 CAGGGTGAGTACAGGGAGGTAGG - Intronic
1061857413 9:133449807-133449829 CAGCGTGAGCTGTGGGAGAGGGG + Exonic
1062053598 9:134459422-134459444 CAGGGTGAGGTCAGGGAGAATGG + Intergenic
1062554609 9:137108265-137108287 CAGCGCAAGCTCAGGGTGGAGGG - Intronic
1185827247 X:3263951-3263973 GAGAGTGAGGTCAGAGAGGATGG - Intergenic
1189010729 X:37043575-37043597 CAGCGCGGGCGCTGGGAGGAGGG + Intergenic
1189035674 X:37491980-37492002 CAGCGCGGGCGCTGGGAGGAGGG - Intronic
1189309323 X:40008912-40008934 CAGCGGGAGCCGCGGGAGGAAGG - Intergenic
1189325509 X:40108816-40108838 CACCGTGGGCTGAGGGAAGAGGG - Intronic
1190290306 X:48988088-48988110 CTGCGTGGGCTCAGGGAGCTGGG - Intronic
1190739381 X:53279468-53279490 CAGCAGGGGCTCAGGGAGGTGGG + Intronic
1191972260 X:66829596-66829618 CAGTTTTAGCCCAGGGAGGATGG - Intergenic
1192499097 X:71637152-71637174 CAGCTTGAGCCTCGGGAGGAAGG - Intergenic
1196032022 X:111101718-111101740 CAGGGTGAGCTCACGTAGGGAGG + Intronic
1197292490 X:124675995-124676017 CAGTGTGAGCTCAGTCAGAAAGG + Intronic
1200039533 X:153355473-153355495 CACAGGGAGCCCAGGGAGGAGGG - Intronic
1200149256 X:153943316-153943338 CACAGGGAGCCCAGGGAGGAGGG + Intronic
1200211192 X:154347263-154347285 CAGCGGCAGTTCAGGCAGGATGG - Intergenic
1201303651 Y:12532196-12532218 CAGTGTGGACTCAGAGAGGAAGG + Intergenic