ID: 1119424974

View in Genome Browser
Species Human (GRCh38)
Location 14:74529133-74529155
Sequence CACAGCACGTGGAGGTGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 319
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 283}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119424964_1119424974 28 Left 1119424964 14:74529082-74529104 CCGGTAGCACAGTCCCTGCAGCA 0: 1
1: 0
2: 3
3: 12
4: 200
Right 1119424974 14:74529133-74529155 CACAGCACGTGGAGGTGGGCAGG 0: 1
1: 0
2: 1
3: 34
4: 283
1119424966_1119424974 15 Left 1119424966 14:74529095-74529117 CCCTGCAGCATGGAGATTGCCTT 0: 1
1: 0
2: 1
3: 9
4: 169
Right 1119424974 14:74529133-74529155 CACAGCACGTGGAGGTGGGCAGG 0: 1
1: 0
2: 1
3: 34
4: 283
1119424968_1119424974 -4 Left 1119424968 14:74529114-74529136 CCTTGTCCGCTGCAACAGACACA 0: 1
1: 0
2: 1
3: 10
4: 135
Right 1119424974 14:74529133-74529155 CACAGCACGTGGAGGTGGGCAGG 0: 1
1: 0
2: 1
3: 34
4: 283
1119424967_1119424974 14 Left 1119424967 14:74529096-74529118 CCTGCAGCATGGAGATTGCCTTG 0: 1
1: 0
2: 1
3: 18
4: 181
Right 1119424974 14:74529133-74529155 CACAGCACGTGGAGGTGGGCAGG 0: 1
1: 0
2: 1
3: 34
4: 283
1119424969_1119424974 -10 Left 1119424969 14:74529120-74529142 CCGCTGCAACAGACACAGCACGT 0: 1
1: 0
2: 0
3: 8
4: 122
Right 1119424974 14:74529133-74529155 CACAGCACGTGGAGGTGGGCAGG 0: 1
1: 0
2: 1
3: 34
4: 283

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119424974 Original CRISPR CACAGCACGTGGAGGTGGGC AGG Intronic
900031828 1:378174-378196 CTCCGCAGGAGGAGGTGGGCTGG + Intergenic
900052376 1:606365-606387 CTCCGCAGGAGGAGGTGGGCTGG + Intergenic
900159789 1:1218108-1218130 CCCAGCAGGTGCAGGTGGGCGGG - Intronic
900485053 1:2918688-2918710 AACAGCACGTGGAGGCCGGTGGG - Intergenic
900752198 1:4405609-4405631 TCCAGCACCTGGAAGTGGGCTGG - Intergenic
901461714 1:9395894-9395916 CAATGCAAGTGGAGGTGAGCAGG - Intergenic
901501137 1:9653072-9653094 AGCCGCACGTGGATGTGGGCGGG + Exonic
903160994 1:21489088-21489110 CACAGGACTTGGAGATGGTCTGG + Intergenic
903654932 1:24943218-24943240 CCCAGCACGTGGGGGAGGCCAGG + Intronic
904296619 1:29523520-29523542 CACAGCAGGAAGAGGTGGGCTGG - Intergenic
904463515 1:30694290-30694312 CACAGCAGGAAGGGGTGGGCTGG + Intergenic
904606911 1:31703040-31703062 CACAGCACATGCAGATGCGCAGG + Intronic
905382746 1:37574926-37574948 CAAAGCTCGTGGAGATTGGCAGG + Intronic
905469265 1:38179571-38179593 GACAGAACGTGGAGCTGGCCGGG - Intergenic
905892452 1:41525933-41525955 CACGGCACGTGGAGGAGGCGTGG + Intronic
906841261 1:49141983-49142005 CACAGCACGAGGTGGTGGGGGGG + Intronic
914803288 1:150975166-150975188 CACAGCAGTTGGGGGTGGGTGGG - Intergenic
915235800 1:154480553-154480575 CGCAGGATGGGGAGGTGGGCAGG - Exonic
915702061 1:157805569-157805591 CACAGCTCTTGGAGCTAGGCAGG + Intronic
919937718 1:202265513-202265535 CACTGTATGTGGGGGTGGGCAGG + Intronic
920069392 1:203291297-203291319 CACAGCACATGGGTGTGGCCCGG - Intergenic
920956296 1:210622912-210622934 GAAAGCAAGTGGAGGTGGGAGGG + Intronic
921104168 1:211959461-211959483 CCCAGCATGTGGACATGGGCCGG + Intronic
922567107 1:226608025-226608047 AACAGCATGTGCATGTGGGCTGG - Exonic
922892143 1:229070301-229070323 CCCAGCCCTTGGGGGTGGGCCGG - Intergenic
1062791148 10:307496-307518 CACACTCCTTGGAGGTGGGCTGG + Intronic
1062922477 10:1290452-1290474 ATCAGCACAGGGAGGTGGGCTGG + Intronic
1062977539 10:1696631-1696653 CACAGCCTGTCCAGGTGGGCAGG - Intronic
1067521412 10:47009438-47009460 CACAACACTTGGAGATGGGCTGG + Intergenic
1067565055 10:47330463-47330485 CACAGCAAGTGGAGAGAGGCTGG + Intergenic
1069780720 10:70953710-70953732 CACAGCCCTGGGAGGTGAGCTGG + Intergenic
1069895748 10:71679157-71679179 CCCAGCACATGGAGGGGAGCAGG + Intronic
1070604890 10:77891769-77891791 CACAGCAGGTGGCTGAGGGCTGG + Intronic
1070817878 10:79336506-79336528 CACAGCATGGGGAGGTGTGGGGG + Intergenic
1073287402 10:102397112-102397134 CTAAGCTCATGGAGGTGGGCTGG - Intronic
1073301490 10:102473704-102473726 CACAGCAGGCTGAGGTGGTCCGG - Exonic
1074370967 10:112900546-112900568 CACAGACCTTGGAGGTGGACTGG - Intergenic
1074820625 10:117175531-117175553 CACAGCACGGGCAGGCGGGCAGG - Intergenic
1074898357 10:117796044-117796066 CCCAGCACCTGGGGGTGGTCGGG + Intergenic
1075430359 10:122375009-122375031 CACAGCACCTGGAGGCCGCCGGG + Intronic
1075618532 10:123908687-123908709 CAGAACAGCTGGAGGTGGGCAGG + Intronic
1076543321 10:131228021-131228043 CACAGCACGGAGAGGGGGGCTGG - Intronic
1076659116 10:132043699-132043721 CACAGCATGACGAGGAGGGCTGG + Intergenic
1076674298 10:132140295-132140317 CACAGGCCGAGGAGGTGGCCTGG - Intronic
1083260289 11:61518837-61518859 CACAGCATGTGGAGGCTGGGGGG - Intronic
1083890463 11:65593259-65593281 CACTGCGCTGGGAGGTGGGCGGG - Intronic
1084189130 11:67491042-67491064 CGCAGCACGGGCAGGGGGGCTGG - Exonic
1084403341 11:68957162-68957184 CACAGCAGCTGGAGGTGGGAGGG + Intergenic
1085036124 11:73301134-73301156 CACAGCTCTTGGAGGTCAGCTGG - Intergenic
1085409850 11:76284474-76284496 CATAGCTGGTAGAGGTGGGCAGG - Intergenic
1085475163 11:76784420-76784442 CACAGGACCCGGAGCTGGGCTGG + Intronic
1088059964 11:105635631-105635653 CACAGCTCGGGCAGGCGGGCAGG - Intronic
1088920287 11:114255557-114255579 CACAACTCGGGGAAGTGGGCTGG - Intergenic
1089171667 11:116515957-116515979 CAGAAAACGTGGAGGTGGCCAGG - Intergenic
1089764414 11:120752422-120752444 CACAGCCCGCCAAGGTGGGCAGG + Intronic
1090731371 11:129575652-129575674 AACTGCAAGTGGAGGTGAGCCGG - Intergenic
1091047187 11:132335072-132335094 AACGGCACGTCGAGGAGGGCAGG + Exonic
1091635998 12:2197096-2197118 CACAGCACCTGGAAGGAGGCAGG - Intronic
1094501073 12:31021152-31021174 CACAGCAGGTGGAGAGGGGAAGG + Intergenic
1096778281 12:53976958-53976980 CACAGCTCCTGGGGGTGGGAAGG + Exonic
1098144370 12:67483926-67483948 CACAGAAGCTGGAGGTGAGCAGG + Intergenic
1099460161 12:82911346-82911368 CACAGAGGCTGGAGGTGGGCGGG - Intronic
1099508879 12:83509331-83509353 CACAGAATGTGGGGGTGGGGTGG + Intergenic
1099738631 12:86601815-86601837 CACAGCAAGTGGATGAGGGTGGG - Intronic
1099975574 12:89542523-89542545 CACAGCATGTAGTGGTTGGCAGG + Intergenic
1102391233 12:112550401-112550423 AACAGCACTTTGAGGTAGGCGGG - Intergenic
1103603273 12:122067904-122067926 CACAACCCTGGGAGGTGGGCAGG - Intergenic
1104856141 12:131903355-131903377 CACAGCCCAAGCAGGTGGGCTGG - Intronic
1105950112 13:25222828-25222850 TACAGACGGTGGAGGTGGGCAGG + Intergenic
1111471493 13:88689150-88689172 CAAAACACTTGGTGGTGGGCTGG - Intergenic
1111857058 13:93651671-93651693 CACTGCACCTGGAGGTGAGGAGG + Intronic
1111888436 13:94052356-94052378 CATAGCATGTAGAGGTGGGTTGG + Intronic
1113965085 13:114148009-114148031 CCCAGCAAGTGGAGGAGGCCGGG - Intergenic
1118233321 14:63975149-63975171 CACGACACATGGAGCTGGGCAGG + Intronic
1118437579 14:65785554-65785576 CCCAGCATGTGGAGGAGAGCAGG + Intergenic
1119424974 14:74529133-74529155 CACAGCACGTGGAGGTGGGCAGG + Intronic
1119949956 14:78734820-78734842 CACAGAAGGTGGAAGTGGGGAGG + Intronic
1121677594 14:95766781-95766803 CTCTGCACTTGGAGGTGGGATGG - Intergenic
1121778836 14:96608720-96608742 CCCAGAACGTGGAGTGGGGCTGG + Intergenic
1122140421 14:99659970-99659992 CACAGCCCGTGGAGTTGGGGTGG - Intronic
1122775035 14:104113330-104113352 CACAGCCTGGGCAGGTGGGCGGG + Exonic
1202926524 14_KI270724v1_random:31171-31193 AACAGCACGGGCAGGTGGGAGGG + Intergenic
1124203311 15:27696966-27696988 CAGAGGACGTGGAGGTGGCACGG - Intergenic
1128982799 15:72198888-72198910 CTCTGCACCAGGAGGTGGGCAGG + Intergenic
1130051460 15:80487247-80487269 CAAGGCACGGGGAGGTGGGCAGG - Intronic
1130052217 15:80493339-80493361 CACAGCAAGTGGCGGGGGGTGGG + Intronic
1131562766 15:93458738-93458760 CAAAGCAAGTGTAGCTGGGCGGG + Intergenic
1131711695 15:95062595-95062617 CACTGCAAGTGGATGTGGTCAGG + Intergenic
1131726210 15:95228096-95228118 AACAGCAGATGGGGGTGGGCTGG - Intergenic
1131763553 15:95650913-95650935 CACAGCACCTGCATGTGGGCAGG - Intergenic
1132273053 15:100543816-100543838 CACCGCACGTGGCTGTGGGTGGG + Intronic
1133061117 16:3175142-3175164 CCCACCAGGGGGAGGTGGGCTGG - Intergenic
1133756739 16:8767538-8767560 CCCAGCAGCTGGAGGTAGGCGGG + Intronic
1133984346 16:10656846-10656868 CTCAGGAGGTGGAGGTGGGAGGG - Intronic
1134310055 16:13067745-13067767 CACAGCAGGTGCAGGCGGACTGG - Intronic
1135628336 16:24015484-24015506 GCCAGCAGGTGGAGGTGGGGTGG + Intronic
1136349587 16:29698156-29698178 CACAGCAGATGGAGGTTTGCTGG + Exonic
1136459007 16:30398446-30398468 CAGAGGAGGTGGGGGTGGGCTGG - Exonic
1136571176 16:31097830-31097852 CCCAGCACTTTGAGGTGGGAAGG - Intergenic
1136573338 16:31109333-31109355 CACACCACGTGGAGATGGCTCGG + Exonic
1137731498 16:50693675-50693697 CCCAGCGCCTGGGGGTGGGCTGG + Intronic
1139391645 16:66609369-66609391 CACAGCATGGGGAGGAGGCCTGG - Intronic
1139779357 16:69338182-69338204 CACAGGAGGTTGAGGTGGGGGGG - Intronic
1140093968 16:71859754-71859776 CACAGCCTGTGGCAGTGGGCTGG + Exonic
1141434550 16:83992381-83992403 AACAGCAAATGGAGGTGGGCGGG - Intronic
1142167107 16:88598022-88598044 AACTGAACGGGGAGGTGGGCGGG - Intronic
1142184524 16:88688269-88688291 CACACAACGGGTAGGTGGGCGGG - Intergenic
1142247439 16:88976460-88976482 CACAGCTGGGGCAGGTGGGCTGG - Intronic
1142324076 16:89402829-89402851 CACTGCGGGAGGAGGTGGGCGGG + Intronic
1142347509 16:89563358-89563380 CCCAGCACTTTGAGGTTGGCTGG + Exonic
1142481162 17:219033-219055 CACAGCAGGGTGAGGAGGGCAGG - Intronic
1142625607 17:1189978-1190000 TCCAGCTGGTGGAGGTGGGCTGG - Intronic
1142809225 17:2387451-2387473 TGCTGCACGGGGAGGTGGGCAGG + Exonic
1144743600 17:17598306-17598328 CAGGGGATGTGGAGGTGGGCAGG - Intergenic
1146655644 17:34633164-34633186 CACAGAACATGGTGGTGGGTGGG + Intronic
1147266313 17:39236938-39236960 CACAGTAGTAGGAGGTGGGCAGG + Intergenic
1147476154 17:40713394-40713416 AACAGCACCTGGAGGAGGGATGG - Intergenic
1147538458 17:41335719-41335741 CACAGCAGGGAGGGGTGGGCAGG + Intergenic
1147993708 17:44350277-44350299 CACAGCACGTGGAGAAGTCCGGG - Exonic
1148741046 17:49892879-49892901 CACAGCACAGGGAAGGGGGCAGG + Intergenic
1149113715 17:53064974-53064996 GACAGCAGGTGGAGGTGGGAGGG + Intergenic
1151751581 17:76041667-76041689 AACAGCACAGGGATGTGGGCAGG - Intronic
1151803080 17:76389095-76389117 CATAGCACCTGGCGGTGGACAGG - Intergenic
1152529422 17:80908345-80908367 GGAAGCACGTGGAGGTGGGCAGG + Intronic
1152890432 17:82878546-82878568 AACAGCACACGGAGGAGGGCAGG - Intronic
1152947829 17:83207540-83207562 CTCCGCAGGAGGAGGTGGGCTGG - Intergenic
1153001091 18:456056-456078 CAAAGCACGTGGTGGGAGGCTGG + Intronic
1153923220 18:9809540-9809562 CAGGCCACGTGGAGGTGGCCAGG - Intronic
1154135662 18:11775487-11775509 CACAGCATGTGCAGCAGGGCTGG + Intronic
1154162561 18:11991003-11991025 CTCAGGCCGTGGAGCTGGGCAGG + Intronic
1154269467 18:12906892-12906914 CACAGCACCTGAGGGTGGGGGGG - Intronic
1155888194 18:31233977-31233999 CCTAGCACGTTCAGGTGGGCTGG - Intergenic
1157384073 18:47247537-47247559 CCCGGCAGGAGGAGGTGGGCCGG + Intronic
1157577468 18:48753111-48753133 CAGGGCATGTGTAGGTGGGCAGG + Intronic
1157595718 18:48862512-48862534 CACATCCCGTGGAGGGTGGCGGG - Intronic
1158350957 18:56563894-56563916 CACAGCACAAGGAGGTGGAGGGG + Intergenic
1160745348 19:708837-708859 CGCAGCGCGGGGAGGTGGGAGGG + Intergenic
1160935189 19:1591507-1591529 CACAGCTCGGGGTCGTGGGCAGG - Intronic
1161417113 19:4153569-4153591 ATCAGCACCTGGAGGTGGGCTGG + Intergenic
1161717776 19:5886498-5886520 CACAGCAAGTGGAGGGAGGCTGG + Intronic
1161779307 19:6280212-6280234 CGCCGCACGTGGAGGGGGGCGGG + Intergenic
1161809884 19:6465470-6465492 CAAAGCAGGTGCAGATGGGCGGG + Intronic
1162550648 19:11356599-11356621 CACAGCGCCTGGAAGTCGGCAGG + Intronic
1162796259 19:13089167-13089189 CACAGTCATTGGAGGTGGGCAGG + Intronic
1163253529 19:16141054-16141076 CACAGCACATGGAGATGAGTTGG - Intronic
1165113297 19:33514317-33514339 CACAGCACGGTGAAGTGGTCTGG + Intronic
1165446287 19:35858536-35858558 CCCAGCACGTGCAGTTGGGCTGG - Exonic
1166053070 19:40272376-40272398 CCCAGCACGTGGAGACGGTCTGG + Intronic
1166343750 19:42152866-42152888 CAGAGCTCTGGGAGGTGGGCAGG + Intronic
1167595845 19:50427804-50427826 CACAGAACGCGGAGGGGGCCTGG + Intronic
1167643328 19:50693719-50693741 CTCAGCATGGGGAGGGGGGCTGG - Intronic
1168508835 19:56958514-56958536 CACAGCAGCTGGAGGCGGGAAGG - Intergenic
925376288 2:3388360-3388382 CACAGCGAGGGGAGGCGGGCTGG - Exonic
925975658 2:9140210-9140232 TACAGCACGTGGAGGGAGGTGGG + Intergenic
927019470 2:19001722-19001744 CACAGCACATGCAGGTGGAAAGG - Intergenic
927132357 2:20071456-20071478 CATAGCAAGTGGGGGTGGACAGG + Intergenic
929893185 2:45936185-45936207 CACAGCAGGCAGGGGTGGGCAGG - Intronic
929945220 2:46366129-46366151 CACCGCACGTGGACGGGTGCTGG + Intronic
930735735 2:54776731-54776753 AACAGGACGTGGGGGTGGGGTGG - Intronic
941662930 2:168214095-168214117 CTTAGGATGTGGAGGTGGGCAGG - Intronic
942109004 2:172661469-172661491 CACTGAATGTGGAGTTGGGCAGG - Intergenic
942261710 2:174171920-174171942 CGCTGCCCGTGGTGGTGGGCTGG - Intronic
943906124 2:193502666-193502688 CACTGCCCGTGGCGGCGGGCCGG + Intergenic
944595650 2:201258314-201258336 CTGAGCACGTGGAGTTAGGCAGG + Exonic
945262428 2:207856220-207856242 CACAACAGGTGGTGGTGGGGTGG - Intronic
947659526 2:231856122-231856144 CACATCATGGGGAGCTGGGCAGG - Intergenic
947860426 2:233354299-233354321 CACGGCCCGGAGAGGTGGGCGGG + Intergenic
948189394 2:236046217-236046239 CACAGCACTCGGTGATGGGCTGG + Intronic
948217102 2:236239970-236239992 CACAGCAAAGGGATGTGGGCTGG - Intronic
948532223 2:238616592-238616614 CACAGCAAGGGGAGGTTGGCGGG - Intergenic
948625735 2:239266853-239266875 CACAGCACCTGGGTGTGGGGTGG - Intronic
948813678 2:240499050-240499072 AACAGCACGTGGAAGTGTGTGGG + Intronic
1168794179 20:600306-600328 CACAGCATCTGGAGCTGAGCAGG - Intergenic
1170367016 20:15609149-15609171 CAGAGCACCTGGGGGTGGGTGGG - Intronic
1172025797 20:31947488-31947510 AACTGCACTTGGTGGTGGGCTGG - Intronic
1172054777 20:32146571-32146593 CACAGAGCATGGAGGTGGGGAGG - Intronic
1172133838 20:32673980-32674002 CACAGATCATTGAGGTGGGCGGG - Intergenic
1172192199 20:33068905-33068927 AACAGCACATGGATGTTGGCTGG - Exonic
1173791960 20:45833856-45833878 CGCAGCCCATGGAGGTCGGCCGG - Exonic
1174113185 20:48210302-48210324 CACTGCACGTGGAGGGAGGCGGG + Intergenic
1175074741 20:56362973-56362995 CTCAGCAGCTGGAGGTGGGTGGG + Intronic
1175634440 20:60568896-60568918 CACATCACATGGAGATGGGGTGG - Intergenic
1176419994 21:6506365-6506387 CAAAGCAGGTGGAGGAGGGTGGG + Intergenic
1176692602 21:9934200-9934222 CAAAGCAGGTGGGGGTGGGGTGG - Intergenic
1176867667 21:14063024-14063046 CACTGCAGGTGGAGTGGGGCGGG + Intergenic
1178068462 21:28934026-28934048 AAAATCACTTGGAGGTGGGCAGG - Intronic
1178676311 21:34634512-34634534 CTGAGCACATGGAGGTGGACAGG - Intergenic
1179695485 21:43114685-43114707 CAAAGCAGGTGGAGGAGGGTGGG + Intergenic
1179932554 21:44579855-44579877 CACAGCAGGAGGAGATGGGCAGG + Exonic
1180192415 21:46172289-46172311 CAGAGCACGAGGCGGTGGGGTGG + Intronic
1181033715 22:20160104-20160126 CAGGGCAAGTGGAGCTGGGCCGG + Intergenic
1181310978 22:21944632-21944654 GACAGCTCATGGAGGTGAGCAGG - Intronic
1183173369 22:36204258-36204280 CAAAGAAGGTGGAGGTGGGGAGG - Intronic
1183423515 22:37725582-37725604 CACAGCACATGGAGGCTGGGAGG - Exonic
1183947371 22:41334267-41334289 CACAGCAAGTGGAGCTGGGCTGG + Intronic
1184931691 22:47686096-47686118 CTCAGCACGTTGAGCTGGACGGG - Intergenic
1184992703 22:48181672-48181694 CAAAGCACAGGGAGGAGGGCAGG + Intergenic
1185286041 22:50000306-50000328 CACAGCGCGTGGATGGGGGGCGG - Intronic
949469532 3:4380102-4380124 CACAGGAGGTGGAGGTGGTAGGG - Intronic
949745801 3:7290956-7290978 AACAGCACCTGGGGGTGGGGAGG - Intronic
950151330 3:10689756-10689778 TCCAGCACGTGGAGGGAGGCTGG + Intronic
950768397 3:15291282-15291304 CACAGCATGTGGAGCTGTGGAGG - Intronic
951497450 3:23347065-23347087 AGCAGAAAGTGGAGGTGGGCAGG - Intronic
954420544 3:50416782-50416804 CTCTGCACCTAGAGGTGGGCAGG - Intronic
955979701 3:64512524-64512546 CATACTAAGTGGAGGTGGGCGGG - Intergenic
960262281 3:115581338-115581360 CACAGCATGTGGAGGTATGTGGG - Intergenic
960754954 3:121001314-121001336 CACTGCAAGTGGATGTGGCCAGG + Intronic
960973977 3:123157894-123157916 CACTGCACGTCAAGGTGTGCAGG + Intronic
961393717 3:126571477-126571499 CAAAGCAGGTGGAGGAGGGCTGG + Intergenic
961550419 3:127667765-127667787 CGCAGCCCCTGGAGCTGGGCTGG - Intronic
961607864 3:128110723-128110745 CACAGCAGGCGGAGCTGAGCGGG - Intronic
962346084 3:134619882-134619904 CACAGCTGGTGGAGTTGGGATGG + Intronic
962426119 3:135270739-135270761 CTCAGAGCGTAGAGGTGGGCCGG - Intergenic
962733679 3:138305187-138305209 CACAGCAGGCAGAGGTGGCCAGG - Intronic
966871345 3:184292125-184292147 CCCAGCACGCGGAAGCGGGCAGG - Exonic
967653347 3:192014495-192014517 CTCAGGAGGTGGAGGTGGGAGGG - Intergenic
968087364 3:195879865-195879887 AACAGCACGATGAAGTGGGCGGG - Intronic
968382685 4:109178-109200 CACAGCAGGTGCAGGGGGACTGG - Intergenic
968488425 4:876458-876480 CGCAGCACCTGCATGTGGGCCGG - Intronic
968650121 4:1757114-1757136 CCAAGCGAGTGGAGGTGGGCAGG + Intergenic
968927170 4:3555666-3555688 CACAGGACCTCAAGGTGGGCTGG - Intergenic
968953883 4:3708479-3708501 GACAGAACGGGGAGGTGGCCAGG + Intergenic
969459691 4:7322381-7322403 CTCAGCAAGTGCAGCTGGGCTGG - Intronic
970336853 4:15055961-15055983 GACAGCACTAGGAGTTGGGCAGG - Intronic
973598182 4:52513762-52513784 CATCTTACGTGGAGGTGGGCAGG - Intergenic
975630966 4:76401879-76401901 GTGAGCAAGTGGAGGTGGGCAGG + Intronic
980365186 4:131794412-131794434 CAAAGCAGGTGGGGGTGGGGTGG - Intergenic
980625277 4:135367142-135367164 CAAAGTACATGGAGGTGTGCTGG - Intergenic
983583170 4:169329286-169329308 CACAGCAGGTGGAGATGGCATGG - Intergenic
984057626 4:174949130-174949152 CACTGCAAGTGGATGTGGTCAGG + Intronic
985577416 5:679865-679887 CAAAGCACGTGCTGATGGGCTGG - Intronic
985592348 5:771961-771983 CAAAGCACGTGCTGATGGGCTGG - Intergenic
985695158 5:1335948-1335970 TCCAGCACGTGGAGGGTGGCGGG - Intronic
985720385 5:1485752-1485774 CACAGCCCGTGCAGGGAGGCCGG + Intronic
986333791 5:6737804-6737826 GACAGCAGGTGCAGGTGCGCCGG - Intronic
987067691 5:14305538-14305560 CACAGCACCTGGAAGAGTGCTGG + Intronic
987296071 5:16552604-16552626 CAGAGAAAGTGGGGGTGGGCAGG - Intronic
987386199 5:17331996-17332018 CACAAAAAGTGTAGGTGGGCCGG + Intergenic
990502567 5:56410929-56410951 CACAGTATGTGGAGTCGGGCAGG - Intergenic
993217970 5:85049451-85049473 CACACCTCCTGGAGGTGGGGGGG + Intergenic
996321440 5:122222020-122222042 CAGGGCATGTGGAGGTGGGGTGG - Intergenic
997374480 5:133387370-133387392 TACAGCCCCTGGCGGTGGGCTGG + Intronic
997590079 5:135067030-135067052 CACCCCACCTGGAGGTGGGCAGG - Intronic
999323157 5:150626990-150627012 CACAGCTCTGGGAGGTGGGCAGG + Intronic
1001470160 5:172006381-172006403 CACCGGACGTTGAGGTGGGCAGG + Intronic
1001773175 5:174311054-174311076 GACAGCAAATGGGGGTGGGCAGG + Intergenic
1001788091 5:174431137-174431159 TATAGCAGGTGGATGTGGGCTGG - Intergenic
1002741992 5:181440694-181440716 CTCCGCAGGAGGAGGTGGGCTGG - Intergenic
1004168559 6:13277652-13277674 CACAGCCCAAGGAGGTGGGTGGG - Intronic
1006079667 6:31558133-31558155 CTCAGCACGTGGGGGTCGACGGG - Exonic
1006155431 6:32010694-32010716 CACAGCCCCTGGGGGTGAGCAGG - Intergenic
1006161737 6:32043428-32043450 CACAGCCCCTGGGGGTGAGCAGG - Exonic
1006171915 6:32097943-32097965 CACAGCCAGTGGAAGGGGGCAGG + Intronic
1006212160 6:32405171-32405193 CAATGCACGTGGAGGTGAGGTGG - Exonic
1006311466 6:33264175-33264197 CACATCACATGGAGGTGGGTTGG - Intronic
1006955107 6:37862574-37862596 CTCAGGAGGTTGAGGTGGGCGGG + Intronic
1007252570 6:40505879-40505901 CAAGGCACGTGGAGATGGGCAGG + Intronic
1007361126 6:41356678-41356700 CACAGAACATGGATGTGGACAGG - Intergenic
1011597434 6:89029593-89029615 CACAGCAGGGGCAGGAGGGCTGG - Intergenic
1012842331 6:104344698-104344720 CACAGCAAGAGAAGGTGGGGTGG + Intergenic
1015201217 6:130583494-130583516 CACAGCAGGAGGCGGTTGGCTGG - Intergenic
1017219523 6:151949883-151949905 CACAGAACCTGGAGGAGGGTGGG - Intronic
1018210943 6:161481019-161481041 AGCAGCACGTGGAAGTGGGCAGG + Intronic
1018570559 6:165205289-165205311 CACAGCAAGTGGAGGTGTCCAGG - Intergenic
1019247129 6:170716432-170716454 CTCCGCAGGAGGAGGTGGGCTGG - Intergenic
1019352873 7:563158-563180 CAGGGCAGGTGCAGGTGGGCAGG + Intronic
1019993133 7:4706405-4706427 AACAGCAAGGGGAGGTGGTCAGG + Intronic
1021570493 7:22059960-22059982 CACAGCATGCCGAGGTGGGTGGG - Intergenic
1023625704 7:42113307-42113329 CACAGGATGTGGTGGTGTGCGGG - Intronic
1023869562 7:44255698-44255720 CCCAGCACTTGGGGCTGGGCTGG + Intronic
1024423810 7:49202215-49202237 CACAGCTCGTGCAGGTGGCATGG - Intergenic
1024462312 7:49671039-49671061 CTCTGCAAGAGGAGGTGGGCTGG - Intergenic
1024565351 7:50675796-50675818 CCCAGCACATGGAGATGGGGAGG + Intronic
1025988193 7:66474269-66474291 CACAGCAGGTGGGGGTGCACAGG - Intergenic
1027152005 7:75739420-75739442 GACGGCCCGTGGAGATGGGCGGG + Intergenic
1027254631 7:76423359-76423381 CAAAGCACGTGAAGGTATGCAGG + Intronic
1033354077 7:140585479-140585501 CAGGGCAGGTGGAGGTGGCCTGG + Intronic
1034054081 7:148016169-148016191 CAAAGGACGTGGAGATTGGCAGG - Intronic
1035269890 7:157713035-157713057 CACAGAACGTGGCTGTGGGCGGG + Intronic
1035501008 8:91502-91524 CTCCGCAGGAGGAGGTGGGCTGG + Intergenic
1039033690 8:33336272-33336294 CACTGAAAGTGGAGTTGGGCAGG + Intergenic
1039193389 8:35002508-35002530 CTCAGCAAGTGGAAGTGGGTGGG - Intergenic
1039227496 8:35404190-35404212 AACAGTATGTGGAGATGGGCTGG + Intronic
1039713818 8:40087447-40087469 CCCAGCTCTTAGAGGTGGGCAGG + Intergenic
1043352878 8:79381949-79381971 GACAGCAGGTGGAGGTGGGTGGG + Intergenic
1045765318 8:105660980-105661002 CACAACACCAGCAGGTGGGCTGG + Intronic
1047301617 8:123618326-123618348 CACAGCAGGAGGTGGGGGGCAGG + Intergenic
1047898841 8:129397686-129397708 CACAGGTGGTGGTGGTGGGCTGG - Intergenic
1049244439 8:141554470-141554492 CACTGCACTTGGAGGAGGGGTGG + Intergenic
1049358721 8:142201680-142201702 CACAGCAGGGAGAGGGGGGCCGG + Intergenic
1049388167 8:142354688-142354710 CATCGCCCGTGGAGGTGGCCTGG - Exonic
1049587559 8:143439058-143439080 CAGAGCCAGTGGAGGTGGGCAGG - Intronic
1049978302 9:881111-881133 CACAGGAGGAGGAGGTGGGGGGG - Intronic
1049997642 9:1047019-1047041 CTCAGCCCGTGGAGCTCGGCCGG - Intergenic
1051022102 9:12556782-12556804 TACAGCACGTGGTAGCGGGCGGG + Intergenic
1051263959 9:15293362-15293384 CTGAGCACCTGGAGGTGGGCTGG + Intronic
1053629544 9:39920265-39920287 CAAAGCAGGTGGGGGTGGGGTGG - Intergenic
1053776222 9:41543282-41543304 CAAAGCAGGTGGGGGTGGGGTGG + Intergenic
1053802095 9:41771076-41771098 CACAGGACCTCAAGGTGGGCCGG - Intergenic
1054143175 9:61544213-61544235 CACAGGACCTCAAGGTGGGCCGG + Intergenic
1054214343 9:62330437-62330459 CAAAGCAGGTGGGGGTGGGGTGG + Intergenic
1054365510 9:64335208-64335230 CAAAGCAGGTGGGGGTGGGGTGG - Intergenic
1054647992 9:67605355-67605377 CACAGGACCTCAAGGTGGGCCGG + Intergenic
1054673141 9:67824921-67824943 CAAAGCAGGTGGGGGTGGGGTGG - Intergenic
1056662160 9:88551981-88552003 CTCAGCATGTGGAGGTGGGAGGG + Intronic
1057079439 9:92161320-92161342 TACAGGACGTGGGGGTGGCCTGG - Intergenic
1057747214 9:97761953-97761975 CACAGGACGTGAAAGTGGGGAGG + Intergenic
1060931316 9:127491315-127491337 CTCACCACGTGAAGGAGGGCAGG - Intronic
1061034583 9:128106557-128106579 GACAGCAGGTGGAGGTGTGCTGG - Intronic
1061906318 9:133701146-133701168 CACTGAATGTGGAGCTGGGCAGG - Intronic
1203607904 Un_KI270748v1:71910-71932 CTCCGCAGGAGGAGGTGGGCTGG - Intergenic
1186406793 X:9311615-9311637 CTCTGCAGCTGGAGGTGGGCTGG - Intergenic
1189238186 X:39505098-39505120 CTCAGCACGGGGTGGAGGGCTGG + Intergenic
1189889438 X:45583910-45583932 AACAGCCCCTTGAGGTGGGCAGG + Intergenic
1190713886 X:53088245-53088267 CACAGCACAGGGAGAGGGGCTGG - Exonic
1196001728 X:110794475-110794497 CACAGGTAGTGGAGGTGGGATGG + Intronic
1197706317 X:129637065-129637087 CACAGCAGCTGGTGGTGGGGGGG + Intergenic
1199820222 X:151438177-151438199 AACAGCAGGTGGAAGTGGCCTGG + Intergenic
1201609376 Y:15823680-15823702 CACAGAATGGGGAGGTGGGATGG + Intergenic