ID: 1119427617

View in Genome Browser
Species Human (GRCh38)
Location 14:74546068-74546090
Sequence GCTTCCCTTCAGTCACATTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119427617_1119427618 -5 Left 1119427617 14:74546068-74546090 CCAGAATGTGACTGAAGGGAAGC 0: 1
1: 0
2: 1
3: 12
4: 157
Right 1119427618 14:74546086-74546108 GAAGCCATGAAGCCACTCCCAGG 0: 1
1: 0
2: 0
3: 17
4: 184

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119427617 Original CRISPR GCTTCCCTTCAGTCACATTC TGG (reversed) Intronic
901147437 1:7075562-7075584 CCTTCCCTGCTGTCACATTTTGG + Intronic
904806798 1:33137860-33137882 GCTTCCCTTGCCTCACAGTCAGG + Intergenic
904880280 1:33691167-33691189 ACTTCTCTTCAATGACATTCCGG - Intronic
905817813 1:40965562-40965584 ACTCCCCTTCTGTCACATTTAGG - Intergenic
907485858 1:54777694-54777716 GTTTCACTTCTGTCACATTCGGG - Intergenic
909060638 1:70875216-70875238 GCTTTCCTTCAGCCACTTTCTGG + Intronic
911195777 1:94993939-94993961 TCTTCCCTGCAGTTACAGTCAGG - Intronic
913141286 1:115943686-115943708 GCTTCCTGTCAGTGAAATTCAGG + Intergenic
914004332 1:143719266-143719288 TCCTCATTTCAGTCACATTCTGG + Intergenic
914372959 1:147046383-147046405 GCTTCCCTGAGTTCACATTCTGG - Intergenic
917410234 1:174752059-174752081 ATTTCCCTTCAGTCAATTTCTGG - Intronic
919176896 1:194030483-194030505 ATTTGCCTTCAGGCACATTCAGG + Intergenic
919415456 1:197302872-197302894 ACTTCCCTTCAGTTGCATACAGG - Intronic
920597718 1:207289874-207289896 GCTTTGCCTAAGTCACATTCAGG - Intergenic
920978735 1:210811419-210811441 ATTTCCCTTCTGTCACATTAGGG + Intronic
1063018344 10:2101083-2101105 GCTGCCCTCCAGTCATGTTCTGG + Intergenic
1063550610 10:7029405-7029427 CCTTCCTTTCAGACTCATTCAGG - Intergenic
1071028603 10:81144613-81144635 GGCTCCTTGCAGTCACATTCTGG + Intergenic
1072760310 10:98051232-98051254 GCTTCTCTCCAGTCACATTGGGG + Intergenic
1073842165 10:107510148-107510170 GCTGATCTTCAGGCACATTCTGG + Intergenic
1075883693 10:125878158-125878180 GGTCTCCTTCAGTCATATTCTGG - Intronic
1081418619 11:42845303-42845325 GCTTCCATTAACTCACGTTCTGG - Intergenic
1082200325 11:49358581-49358603 TTTTCACTTGAGTCACATTCTGG + Intergenic
1082979543 11:59107016-59107038 CCTTCCCTTCAATCACTGTCTGG + Intergenic
1085703049 11:78762289-78762311 GCCTCCCTTGAACCACATTCTGG + Intronic
1086655347 11:89347626-89347648 TTTTCCCTTGAGTCACATTCTGG - Intronic
1090946122 11:131431134-131431156 GCCACCCTTCAGCCAAATTCAGG + Intronic
1091740908 12:2959766-2959788 TTTTCCCGTCAGTCCCATTCTGG + Intronic
1092636299 12:10454379-10454401 GCTTGCCTTCAGCCCCATTTAGG + Exonic
1098042106 12:66362697-66362719 GCTTCCCTTAAGTTTGATTCTGG - Intronic
1104194136 12:126514731-126514753 GATTGCCTGCAGGCACATTCTGG + Intergenic
1104412950 12:128574517-128574539 GCTTCAGATCAGTCAAATTCAGG - Intronic
1106287475 13:28330040-28330062 GCTTCCCTTCTGTCAGAACCAGG + Intronic
1107108202 13:36669443-36669465 CCTCCCCTTCAGTCTTATTCAGG - Intergenic
1107438963 13:40407080-40407102 GCTTCTCTTTAGTCACATGAGGG - Intergenic
1108526002 13:51286551-51286573 GCTTCCCCACAGCCACCTTCAGG - Intergenic
1108527301 13:51296804-51296826 GCTTCCTGTCACTCACAATCAGG + Intergenic
1110688716 13:78405806-78405828 ACTTCTTTTCAGTCTCATTCTGG - Intergenic
1112692682 13:101915830-101915852 GCAGCCCTTCAGTCAAATCCTGG - Intronic
1114215144 14:20652429-20652451 GCTATCCTATAGTCACATTCTGG + Intergenic
1115414644 14:33117341-33117363 GCTTCCCAGCAGTCAGTTTCAGG - Intronic
1117819594 14:59633893-59633915 GATTCCCATCAGTAAAATTCTGG - Intronic
1119422624 14:74516634-74516656 CCATCCCCTCAGTGACATTCTGG - Intronic
1119427617 14:74546068-74546090 GCTTCCCTTCAGTCACATTCTGG - Intronic
1121407860 14:93729753-93729775 GCTTCACTGCATTCACATCCTGG + Intronic
1121776531 14:96594493-96594515 GCTTCACTCTAGTCCCATTCCGG + Intergenic
1122185411 14:99989234-99989256 GGTTCCCTCCTGTCACATCCAGG + Intronic
1122594410 14:102879193-102879215 GCCTCCCTTCAGTCACTTCATGG - Intronic
1125027905 15:35049192-35049214 GTTTCCCTTAAGTCATATTGTGG - Intergenic
1125483620 15:40097500-40097522 GCTGCCCAGCAATCACATTCCGG - Intronic
1125601085 15:40916138-40916160 GTAACCCTTCAGTCACTTTCTGG + Intergenic
1126758175 15:51944593-51944615 ACTTCCCTTAAGTTTCATTCAGG - Intronic
1129877284 15:78983963-78983985 GCTACCCTTCCCTCACCTTCTGG - Intronic
1130644631 15:85713476-85713498 ACCTCCCTTCAGAAACATTCAGG + Intronic
1131406144 15:92166549-92166571 GCTTCCCCTCACTCACACTATGG + Intronic
1134202356 16:12209604-12209626 GCATCCCTTCAGCCACCTACAGG - Intronic
1135568202 16:23528335-23528357 GCTTCCCTGCAGTGCCATTGGGG - Intronic
1137467664 16:48725574-48725596 ACTACCCTTCACTCACTTTCTGG + Intergenic
1143132928 17:4691929-4691951 TCTCCCCTTCTCTCACATTCTGG + Intronic
1147754620 17:42760572-42760594 CCTTCCCTTCAGACACCTCCTGG - Intronic
1148965962 17:51436354-51436376 GCTTCCCTTCACACCCATGCTGG + Intergenic
1152549341 17:81021541-81021563 GCCTCCCTACAGACACAGTCTGG + Intergenic
1152776463 17:82204957-82204979 GCTTCCCTGCAGTGATGTTCAGG - Intronic
1164438212 19:28250895-28250917 TCTTCCCTACAGTTACTTTCTGG - Intergenic
1167483570 19:49747177-49747199 CTTGCCCTGCAGTCACATTCAGG - Intronic
928157406 2:28889153-28889175 GCTTCTCTTCAGTGGCCTTCAGG + Intergenic
928215027 2:29354286-29354308 GCTTCCCTTCTATCACAGCCAGG - Intronic
933646781 2:84819666-84819688 GCTTCCCATCAGTTACTTTCTGG + Intergenic
934621578 2:95812854-95812876 GGTTCCCTCCAGTCTCTTTCTGG - Intergenic
934811862 2:97285961-97285983 GGTTCCCTCCAGTCTCTTTCTGG + Intergenic
934825829 2:97421979-97422001 GGTTCCCTCCAGTCTCTTTCTGG - Intergenic
934973790 2:98786219-98786241 GGTCCCCTGTAGTCACATTCAGG + Intergenic
935742313 2:106160421-106160443 ACTTCCCCTCACTCACCTTCAGG + Intronic
936814462 2:116443036-116443058 GCTTCCATTAAATGACATTCTGG + Intergenic
938587744 2:132707943-132707965 GGTTCCCTTCAGTATCATCCCGG - Intronic
944531311 2:200670283-200670305 CTTTCCCTTCAGTCAAAGTCAGG - Intronic
945130382 2:206565016-206565038 GATTCTGTGCAGTCACATTCTGG - Exonic
946983267 2:225242726-225242748 TCATCTCTTCAATCACATTCTGG + Intergenic
947763625 2:232621899-232621921 TCTTCCCTTCAGACACAACCAGG - Intronic
1169288397 20:4328484-4328506 GCTTTCCATCAGTCACAGCCTGG - Intergenic
1173109042 20:40168165-40168187 CCTTACCTTCAGTCACATTGAGG + Intergenic
1174708978 20:52685218-52685240 GCTTCATTTCAGTCACAGTGAGG + Intergenic
1175087962 20:56476981-56477003 GCTTCAGCTCTGTCACATTCTGG - Exonic
1175299364 20:57932154-57932176 GCTTCCGTGCAGGCACATGCAGG - Intergenic
1178421135 21:32444311-32444333 TCTTCCCAGCAGTCACAGTCTGG + Intronic
1178871580 21:36381589-36381611 GCTTACCTTCAGTCATACTATGG - Intronic
950868887 3:16212286-16212308 GCTGCCCTTCAAACACATGCAGG - Intronic
951555879 3:23920246-23920268 GAATCCCTTCAGTCACATTAGGG + Exonic
953593795 3:44287919-44287941 GCTGCCTTTTATTCACATTCTGG + Intronic
954572067 3:51649333-51649355 GGTTCCATTCTGTCACTTTCAGG - Intronic
956052715 3:65265705-65265727 GCTTCCCTTCAGGCCTATCCTGG - Intergenic
957050257 3:75406226-75406248 TCTTCCCAGCAGTCACAGTCTGG - Intergenic
958707943 3:97679668-97679690 GTTTCCATTTATTCACATTCAGG - Intronic
959391211 3:105776499-105776521 CCTTATCTTCAGTCACATGCTGG - Exonic
959640771 3:108631137-108631159 GTTTCCCTTCACTCTCATCCTGG + Intronic
961566282 3:127765691-127765713 GCTTCCCTTCAGTGATGTTGGGG - Intronic
961953318 3:130773144-130773166 GTTTCCATTGAGTCATATTCAGG - Intergenic
962242861 3:133766128-133766150 ACTTCCCCTCAGTCAGATACTGG + Intronic
962894893 3:139705238-139705260 GCTGCTCTTCAGTGACAGTCTGG + Intergenic
964949400 3:162269675-162269697 GTTTCCGTTCAATTACATTCAGG + Intergenic
966123576 3:176549597-176549619 CCTTCCCTTTAGTCACAAACTGG - Intergenic
966444399 3:179985801-179985823 GCCTCCCCTCAGTCCCATTTTGG + Intronic
966847361 3:184140950-184140972 GGTACCCTGTAGTCACATTCAGG + Intronic
967086834 3:186102787-186102809 GCTTCACTCCAGTCATTTTCTGG - Intronic
967282954 3:187840169-187840191 GCTTTCCTTTAGCCACATTTTGG + Intergenic
969459909 4:7323622-7323644 GAATCCCTTCAGTCACAGGCAGG + Intronic
970138501 4:12953477-12953499 GCTTCACTTCATTCACTTTCAGG - Intergenic
971388412 4:26162381-26162403 GCTTCTCTTAAGTAACATTATGG - Intergenic
972622015 4:40756381-40756403 GCTTCTCTTCAGTCTGCTTCAGG - Intronic
974397665 4:61359584-61359606 GCTTCCTACCAGTTACATTCAGG + Intronic
977658852 4:99559767-99559789 GTTTCCTTTCACTGACATTCAGG - Intronic
977957701 4:103049417-103049439 TCTTCACTTTAGTCTCATTCTGG - Intronic
984919208 4:184749212-184749234 AGTTCCCTCCAGTCAGATTCTGG + Intergenic
985661077 5:1156732-1156754 GGTTCCCTTCTGTCACCTGCAGG - Intergenic
986139588 5:5017444-5017466 CCATCCCTTCAGTTCCATTCTGG - Intergenic
990645707 5:57841820-57841842 GCTTCCTTTCACTCTCATGCTGG - Intergenic
993019624 5:82576295-82576317 TCTTTCCTTTGGTCACATTCAGG + Intergenic
994177457 5:96726992-96727014 GCTGCCCATCAGCCACATTCTGG + Intronic
995352416 5:111194976-111194998 GCTCCACTTCAGTAACAATCAGG - Intergenic
996498351 5:124187805-124187827 GCTTCCCTTGAGTCAGTTCCTGG + Intergenic
996543115 5:124650100-124650122 GATTCCTTTCAGTCACCCTCTGG - Intronic
996833073 5:127761072-127761094 GCTCCCCTTCAAGCCCATTCTGG + Intergenic
997818029 5:137036696-137036718 GCCTCCCTCCCATCACATTCCGG - Intronic
1003023186 6:2529825-2529847 GCTGCGTTGCAGTCACATTCAGG + Intergenic
1004111814 6:12726028-12726050 CCTTCCCTTCAGTCTTATGCAGG - Intronic
1007776279 6:44226176-44226198 GCTTCCCTTCCCTCCCTTTCTGG - Intronic
1008325208 6:50171813-50171835 GTTTCCTTTCACTGACATTCAGG - Intergenic
1008401254 6:51065986-51066008 GCTTCCCTCCAGTCCAATTTCGG + Intergenic
1013510535 6:110840588-110840610 GCCACCCTTCAGGAACATTCAGG + Intronic
1014162331 6:118184823-118184845 ACTTCACCTCAGTCACATTTAGG + Intronic
1014342375 6:120226800-120226822 CCTTCCCTTTAGCCACATTGGGG - Intergenic
1015509869 6:134027614-134027636 GCCTCCCTACAGAGACATTCAGG + Intronic
1015564195 6:134550223-134550245 TCTTCTCTTCAGTCACTTTTGGG + Intergenic
1015874784 6:137811898-137811920 TCTTCCTTTCAGCCACATTTCGG + Intergenic
1015992351 6:138959233-138959255 CGTTCCCTGCAGTCTCATTCTGG - Intronic
1016588377 6:145715629-145715651 GCTCCCCATCACTCACATTACGG + Intronic
1018380657 6:163255380-163255402 GCTGCCCGTCAGTCACCTCCTGG - Intronic
1019340503 7:506790-506812 GCTGCCGGTCAGTCACATCCTGG + Intronic
1029214326 7:98934975-98934997 CCTTCTCTTCATTCACATCCTGG - Intronic
1029955591 7:104635764-104635786 ACTTCCCTTCATTCTCATACTGG - Intronic
1030295120 7:107917202-107917224 ACTTACCTTCAGTTACATTATGG - Intronic
1031050847 7:116943914-116943936 GAATCCCTTCAGTCACAGTGGGG - Intergenic
1034279197 7:149839861-149839883 GCTTCTCTTTATTCAAATTCAGG - Intronic
1034435491 7:151061058-151061080 GACTCCCTACAGTCACAGTCAGG + Intronic
1036410853 8:8499109-8499131 GTTTCCCTTCAGTTACATTCAGG + Intergenic
1036634609 8:10540402-10540424 GCTTTTCTTCAGTCTCTTTCTGG - Intronic
1038494193 8:27990129-27990151 GCTGCCCTTCACACACATTCTGG - Intronic
1040590544 8:48788723-48788745 GCTGCCATGCAGTCACATTAAGG - Intergenic
1043162783 8:76867346-76867368 GCCTCCCTTAAGTCACCTTCAGG - Intergenic
1044741599 8:95332798-95332820 TCCTCCCTCCAGACACATTCTGG - Intergenic
1045435936 8:102163987-102164009 GTTTCCCTGAAGCCACATTCAGG - Intergenic
1045907356 8:107363058-107363080 GGTTCCCTGCTGACACATTCTGG - Intronic
1046040376 8:108896508-108896530 GCTTCCTTTCTGACACAGTCTGG + Intergenic
1046681821 8:117179002-117179024 GCTTCCCTTCAGTTAGGTTAGGG - Intergenic
1049331749 8:142058241-142058263 TCTTTCCCTCAATCACATTCTGG - Intergenic
1049387525 8:142351104-142351126 GCTTCCCTGCTGTGTCATTCCGG - Intronic
1049510268 8:143023749-143023771 GTTTCCCTGCAGTCAGATCCAGG - Intronic
1051717261 9:19998269-19998291 TCTTCCATTCAGACCCATTCAGG + Intergenic
1052380775 9:27768393-27768415 CCTTCCTTTCAGTCAGATTTAGG + Intergenic
1052497824 9:29250148-29250170 GTTTTCCTTCAGTCATTTTCTGG - Intergenic
1059331515 9:113538573-113538595 GCCTGCCTTCAGTCACCCTCTGG - Intronic
1061017590 9:127990969-127990991 GCTTCCCTCCACTCCCATTGGGG - Intergenic
1061835084 9:133323427-133323449 CCTTCCCAGCAGTCCCATTCAGG - Intergenic
1185534546 X:850344-850366 CCTTTCCTTCAGACACAGTCTGG - Intergenic
1187390635 X:18884501-18884523 GCTTACCTTCAGACACACCCTGG + Intergenic
1188482552 X:30650407-30650429 GCTTCCCTTCCCTCAGACTCTGG + Intergenic
1189438797 X:41016250-41016272 GCAGCCCTTCAGTCTCATTCAGG - Intergenic
1191776980 X:64825112-64825134 GCTTCTCTTCATTCACCTACAGG + Intergenic
1193460846 X:81789628-81789650 GCTTTCATTGAGTCACATTAAGG + Intergenic
1197746633 X:129935891-129935913 GCTTCCCTTCTTCCACAGTCTGG - Intergenic
1199098471 X:143769173-143769195 GCTTTCTCTCAGTCCCATTCAGG - Intergenic