ID: 1119430568

View in Genome Browser
Species Human (GRCh38)
Location 14:74565648-74565670
Sequence TCTCCCAAGTTCTGCCTCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 680
Summary {0: 1, 1: 0, 2: 3, 3: 65, 4: 611}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119430568_1119430575 6 Left 1119430568 14:74565648-74565670 CCCAGGAGGCAGAACTTGGGAGA 0: 1
1: 0
2: 3
3: 65
4: 611
Right 1119430575 14:74565677-74565699 TGGGGCTGTAGACACAGTTGGGG 0: 1
1: 0
2: 1
3: 16
4: 228
1119430568_1119430578 14 Left 1119430568 14:74565648-74565670 CCCAGGAGGCAGAACTTGGGAGA 0: 1
1: 0
2: 3
3: 65
4: 611
Right 1119430578 14:74565685-74565707 TAGACACAGTTGGGGCTGGGAGG 0: 1
1: 0
2: 5
3: 32
4: 294
1119430568_1119430577 11 Left 1119430568 14:74565648-74565670 CCCAGGAGGCAGAACTTGGGAGA 0: 1
1: 0
2: 3
3: 65
4: 611
Right 1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG 0: 1
1: 0
2: 0
3: 26
4: 217
1119430568_1119430579 17 Left 1119430568 14:74565648-74565670 CCCAGGAGGCAGAACTTGGGAGA 0: 1
1: 0
2: 3
3: 65
4: 611
Right 1119430579 14:74565688-74565710 ACACAGTTGGGGCTGGGAGGAGG 0: 1
1: 0
2: 5
3: 51
4: 729
1119430568_1119430576 10 Left 1119430568 14:74565648-74565670 CCCAGGAGGCAGAACTTGGGAGA 0: 1
1: 0
2: 3
3: 65
4: 611
Right 1119430576 14:74565681-74565703 GCTGTAGACACAGTTGGGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 198
1119430568_1119430573 4 Left 1119430568 14:74565648-74565670 CCCAGGAGGCAGAACTTGGGAGA 0: 1
1: 0
2: 3
3: 65
4: 611
Right 1119430573 14:74565675-74565697 TTTGGGGCTGTAGACACAGTTGG 0: 1
1: 0
2: 2
3: 22
4: 164
1119430568_1119430574 5 Left 1119430568 14:74565648-74565670 CCCAGGAGGCAGAACTTGGGAGA 0: 1
1: 0
2: 3
3: 65
4: 611
Right 1119430574 14:74565676-74565698 TTGGGGCTGTAGACACAGTTGGG 0: 1
1: 0
2: 1
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119430568 Original CRISPR TCTCCCAAGTTCTGCCTCCT GGG (reversed) Intronic
900350097 1:2230216-2230238 TCACCCAAGCTCTGTCTCCTGGG - Intronic
901700633 1:11043325-11043347 TTTCTCAAGGTCTGGCTCCTGGG - Exonic
902878416 1:19354834-19354856 TCTCCCACATCCTGCCACCTGGG - Intronic
903187532 1:21637230-21637252 CATTCCAACTTCTGCCTCCTGGG + Intronic
903375293 1:22862047-22862069 TCTCCCAGCTTCAGCCTGCTGGG - Intronic
903465692 1:23551250-23551272 ACTCCCAAGCTCTGCCACCCTGG - Intergenic
904070119 1:27788934-27788956 TCACGCAAGCTCCGCCTCCTGGG - Intronic
904748804 1:32727887-32727909 CCTCCCAACTCCTACCTCCTGGG + Intergenic
904912988 1:33949358-33949380 CATCCCATGTTCTGGCTCCTGGG - Intronic
906396115 1:45466397-45466419 TCACTCAACCTCTGCCTCCTGGG - Intronic
907212496 1:52835653-52835675 GCTCACCACTTCTGCCTCCTGGG - Intergenic
907407456 1:54262444-54262466 TCTCCCAAGTCCTTCAGCCTTGG - Intronic
907549564 1:55292765-55292787 TCTCAGAAGTGCTGACTCCTTGG + Intergenic
908198261 1:61767429-61767451 TCTGCCAACATCAGCCTCCTAGG - Intronic
909099154 1:71329814-71329836 ACTCTCAAGCTCCGCCTCCTGGG + Intergenic
909626572 1:77723738-77723760 ACTGCCAAGTTCTGCCTCCCGGG + Intronic
910628484 1:89333721-89333743 TCATTCAAGCTCTGCCTCCTGGG - Intergenic
911059951 1:93739101-93739123 TCTCCCAGGTTCTGCTCCCTGGG + Intronic
911349602 1:96737053-96737075 TCCTGCAAGCTCTGCCTCCTGGG + Intronic
912756644 1:112329815-112329837 CCTCACCTGTTCTGCCTCCTTGG - Intergenic
912802076 1:112726059-112726081 TACCGCAACTTCTGCCTCCTAGG - Intronic
913310637 1:117488269-117488291 TGTTGCAACTTCTGCCTCCTGGG + Intronic
913478869 1:119265435-119265457 CATCGCAACTTCTGCCTCCTGGG - Intergenic
913714115 1:121516875-121516897 TACCGCAAGCTCTGCCTCCTGGG + Intergenic
913997592 1:143664164-143664186 TCACGCAACTTCTGCCTCCCAGG + Intergenic
914796414 1:150923999-150924021 CCTCCCGGGTTCCGCCTCCTGGG - Intergenic
915062125 1:153194898-153194920 TCTCCCTAATTCTCCATCCTTGG - Intergenic
915117590 1:153610415-153610437 TCTCCCACCACCTGCCTCCTTGG + Intronic
915139169 1:153755962-153755984 TATCGCAACCTCTGCCTCCTGGG - Intronic
915419339 1:155766968-155766990 TCTCGCAACCTCTGCCTCCCAGG - Intronic
917369055 1:174269016-174269038 TCACACAAGCTCTGCCTCCCCGG + Intronic
917478662 1:175391247-175391269 TCTCCCTAGAGCTGCCTACTAGG - Intronic
918080365 1:181203260-181203282 TCTCCCTACTACTGCCTCCCTGG - Intergenic
918362642 1:183774649-183774671 TCACACAACCTCTGCCTCCTGGG + Intronic
918869339 1:189948584-189948606 TCTCCCTAGATGTACCTCCTTGG - Intergenic
919093178 1:192998107-192998129 TGTCCCATGTTCTGCCACCAAGG - Intergenic
919183255 1:194112526-194112548 TCGTACAATTTCTGCCTCCTGGG - Intergenic
919889430 1:201959922-201959944 ACTGCCAAGTTCCGCCTCCCGGG - Intronic
920319200 1:205104761-205104783 TCACACAACCTCTGCCTCCTGGG - Intronic
920852093 1:209634813-209634835 TCTCCCAGGATCTGCCTTCCAGG + Intronic
921015885 1:211190526-211190548 TCACGCAAGCTCTGCCTCCCGGG - Intergenic
921914343 1:220590399-220590421 TCTCCTGAGTTCTCTCTCCTTGG + Intronic
922239248 1:223744783-223744805 CCTCCCAACCTCTGCCTCCCAGG - Intronic
922295744 1:224248468-224248490 TCTGCCCTGTTCTCCCTCCTCGG + Intronic
922298358 1:224272267-224272289 CTTCGCAACTTCTGCCTCCTGGG - Intronic
924752346 1:246905945-246905967 ACTCCCCAGTTCTACCTCTTGGG - Intronic
1063079742 10:2754534-2754556 TCTCCTAGGTCCTGTCTCCTTGG + Intergenic
1063218206 10:3943005-3943027 TCCCCCAAATTCTGCGTGCTCGG - Intergenic
1063505913 10:6599634-6599656 TATCTCAAGTTCTGCTTTCTTGG - Intergenic
1063708232 10:8451884-8451906 TATTGCAACTTCTGCCTCCTGGG + Intergenic
1064520758 10:16198372-16198394 CCTCACAACCTCTGCCTCCTGGG - Intergenic
1064706923 10:18082613-18082635 TCCCCCATTTTCTGGCTCCTTGG + Intergenic
1064710571 10:18119852-18119874 TCTAACAAGTTCTGCCTGCTGGG - Intergenic
1064962067 10:20976263-20976285 ACTGCCAACTTCTGCCTCCTGGG - Intronic
1064984025 10:21192265-21192287 TACTGCAAGTTCTGCCTCCTGGG + Intergenic
1065409392 10:25407142-25407164 TATCTTAAGTTCTGCTTCCTGGG + Intronic
1066045470 10:31591083-31591105 CATCACAACTTCTGCCTCCTAGG - Intergenic
1066120598 10:32282410-32282432 TCCCCCAACCTCAGCCTCCTGGG - Intronic
1066605212 10:37159768-37159790 TCACGCAAGCTCTGCCTCCCGGG + Intronic
1066605931 10:37170873-37170895 TCACGCAAGCTCTGCCTCCCGGG + Intronic
1066606714 10:37182665-37182687 TCACGCAAGCTCTGCCTCCCGGG + Intronic
1067527758 10:47048557-47048579 TCCCCCAACTACTGCCTTCTTGG - Intergenic
1067658779 10:48218042-48218064 TCTCCCAAGGACTCTCTCCTTGG + Intronic
1067970821 10:50968433-50968455 GATCCCAATTTCTGTCTCCTAGG - Intergenic
1068427922 10:56891740-56891762 CCTCCCAACCTCTGCCTCCCAGG + Intergenic
1069326766 10:67240685-67240707 TCTCCCAAGGTGTGCATTCTGGG + Intronic
1070393320 10:75989884-75989906 TCTCCTAACTTCAGCCTACTGGG - Intronic
1070586228 10:77768804-77768826 TCTCCAGAGTTCTGTCCCCTTGG - Intergenic
1070713502 10:78700714-78700736 TCTCCCAAGTTGAGCCTCCAGGG + Intergenic
1071461501 10:85901320-85901342 ACTGCCAAGCTCTGCCTCATGGG + Intronic
1071543799 10:86511853-86511875 TATCACAGGTTCTACCTCCTGGG - Intronic
1071615821 10:87075173-87075195 TCAGCCAACCTCTGCCTCCTGGG + Intronic
1071625479 10:87164326-87164348 TACTCCAACTTCTGCCTCCTGGG + Intronic
1071711190 10:88051207-88051229 TCTCTCAGGTTCTGTCTCCTTGG + Intergenic
1072416563 10:95251498-95251520 TTTAGCAACTTCTGCCTCCTAGG - Intronic
1072538667 10:96382105-96382127 TCACCCAACCTCTGCCTCCCTGG + Intronic
1072585851 10:96781516-96781538 TCACCCAAGCTCTGCCTCCCGGG + Intergenic
1072720071 10:97774903-97774925 TGTGCAAAGTGCTGCCTCCTTGG + Intergenic
1072796464 10:98358810-98358832 TCCTGCAAGCTCTGCCTCCTGGG - Intergenic
1072927624 10:99630202-99630224 TCACTCAAACTCTGCCTCCTGGG + Intergenic
1073362254 10:102909347-102909369 ACTGCAAACTTCTGCCTCCTGGG + Intergenic
1073489600 10:103844279-103844301 TGTCCTGAATTCTGCCTCCTGGG - Intronic
1073738005 10:106371985-106372007 TGGCGCAACTTCTGCCTCCTGGG - Intergenic
1073983874 10:109186064-109186086 ACTTGCAAGCTCTGCCTCCTGGG - Intergenic
1074708940 10:116161055-116161077 ACTCCTGAGTTCTGCCTCCCAGG - Intronic
1075032567 10:119034249-119034271 TCTCCCAAGTTCTTTGTTCTGGG - Exonic
1075189551 10:120294180-120294202 TCCTCCTACTTCTGCCTCCTGGG + Intergenic
1075667414 10:124240960-124240982 CCTTCCAAGTTCAGCCTCCGTGG - Intergenic
1075768042 10:124910178-124910200 CCTCCCAGGCTCAGCCTCCTGGG - Intergenic
1077212345 11:1377302-1377324 CCTCCCAAGGTCTCTCTCCTCGG - Intergenic
1077581125 11:3417985-3418007 TCTCCCTCACTCTGCCTCCTGGG - Intergenic
1078019219 11:7641355-7641377 TCTGCCCAGTTCTGCCTTCAGGG - Intronic
1078375112 11:10786791-10786813 TCACTCAACCTCTGCCTCCTGGG + Intergenic
1079082437 11:17423279-17423301 CCTCACAAGCTCTGCCTCCTAGG - Intronic
1079120938 11:17684378-17684400 TGTCTCAGGTTCTGCCTTCTGGG - Intergenic
1079249305 11:18775539-18775561 CCTCCCAAGGCCTGCTTCCTGGG - Intronic
1080529794 11:33163614-33163636 GCTCCCAAGCTCCGCCTCCTGGG + Intergenic
1081149876 11:39615016-39615038 TCTCGCAAGCTCTGCCTCCCGGG + Intergenic
1081695419 11:45106050-45106072 TCTCTCCAGTTCCTCCTCCTGGG + Intronic
1081989017 11:47327742-47327764 TCCCCCAAATTCTACCTCCCAGG + Intronic
1082109253 11:48256037-48256059 TCTTCAAAGTTCTGTGTCCTTGG - Intergenic
1082790946 11:57346475-57346497 TCTCCCAGCTTCTGTCTGCTGGG + Intronic
1083213178 11:61202172-61202194 TCTCACAACCTCTGCCTCCCAGG + Intergenic
1083216063 11:61220917-61220939 TCTCATAACCTCTGCCTCCTGGG + Intergenic
1083218947 11:61239743-61239765 TCTTACAACCTCTGCCTCCTGGG + Intergenic
1083461353 11:62814535-62814557 TCACCCAACTTCCGCCTCCCAGG + Intronic
1083925118 11:65801391-65801413 TCTCCCTGGCTCTGCCTTCTTGG - Intergenic
1083984931 11:66207843-66207865 TATTCCAACATCTGCCTCCTAGG + Intronic
1084238053 11:67800823-67800845 TCTCCCTCACTCTGCCTCCTGGG - Intergenic
1084834357 11:71792011-71792033 TCTCCCTCACTCTGCCTCCTGGG + Intronic
1084926585 11:72517856-72517878 TCCCCCTACTTCAGCCTCCTGGG - Intergenic
1085534973 11:77212220-77212242 CCTCCCGAGCTCTGCCACCTGGG - Intronic
1085779999 11:79399423-79399445 ACTCCCCAGTTCTTCTTCCTTGG - Intronic
1086106290 11:83151126-83151148 ACTGCCAACTTCTGCCTCCCAGG - Intergenic
1086241587 11:84700133-84700155 TCACCCAAGTTCTTCTTGCTGGG - Intronic
1086398295 11:86439996-86440018 TCTTCCAAGAACTGCTTCCTTGG - Intergenic
1086812296 11:91325361-91325383 TCCCACAAATTCTGCCTCCTAGG + Intergenic
1087180307 11:95135551-95135573 TCGCCCAAGCTCCGCCTCCCAGG + Intergenic
1088092441 11:106058497-106058519 TCACCCAACCTCAGCCTCCTGGG + Intronic
1088094119 11:106077923-106077945 TCCCCCAAGATCTGCTTCCTAGG - Intronic
1089207899 11:116779638-116779660 TCTTCTAACTTCTGCCTCCTTGG + Intronic
1089213909 11:116823932-116823954 ACTCCCATGCTGTGCCTCCTTGG + Intergenic
1090402135 11:126455718-126455740 ACTGGCAAGCTCTGCCTCCTGGG - Intronic
1091044429 11:132313021-132313043 TCACCCAACATCTGCCTCCAGGG - Intronic
1091540962 12:1461590-1461612 TCACGCAACCTCTGCCTCCTGGG - Intronic
1091552720 12:1548947-1548969 TCACGCAAGCTCCGCCTCCTGGG - Intronic
1091627907 12:2136945-2136967 GCTCCCAAGATCTGCTTCCAAGG - Intronic
1091939259 12:4461493-4461515 GCTCACAAGCTCCGCCTCCTGGG - Intergenic
1092282144 12:7105879-7105901 TCTCTTTTGTTCTGCCTCCTGGG - Intronic
1092408723 12:8238453-8238475 TCTCCCTCACTCTGCCTCCTGGG - Intergenic
1092505719 12:9097706-9097728 TCACTCAACCTCTGCCTCCTGGG + Intronic
1092802894 12:12188345-12188367 TCTGCCCATCTCTGCCTCCTGGG - Intronic
1093310389 12:17575026-17575048 TCTCCCAGATTCTTCCTTCTAGG + Intergenic
1094306396 12:29024496-29024518 TCTCCTAAGTTCTGACACCCTGG + Intergenic
1095922158 12:47542456-47542478 TCTCCCAAGTTCTCCCAACAAGG - Intergenic
1097116803 12:56703469-56703491 TATTGCAAGCTCTGCCTCCTGGG - Intergenic
1097285728 12:57875683-57875705 TCACGCAACCTCTGCCTCCTGGG - Intergenic
1097835512 12:64269062-64269084 TATCACAATCTCTGCCTCCTGGG - Intronic
1098189937 12:67937391-67937413 TCTCCCAAGCTTTGCCCCCATGG - Intergenic
1098473518 12:70872618-70872640 TCATGCAAGCTCTGCCTCCTGGG - Intronic
1099006906 12:77244804-77244826 TTGTCCAAGTTCTGCCTTCTAGG + Intergenic
1099470364 12:83040758-83040780 TCACGCAAGCTCTGCCTCCCGGG + Intronic
1100057573 12:90531395-90531417 TCACCCAACCTCTGCCTCCCAGG - Intergenic
1100096284 12:91041593-91041615 TCTCCTGAGTCCTCCCTCCTTGG - Intergenic
1100541579 12:95562382-95562404 CACCCCAACTTCTGCCTCCTGGG + Intergenic
1100691375 12:97041784-97041806 TCACACAAGCTCCGCCTCCTGGG - Intergenic
1101075978 12:101130329-101130351 TCTCCCAAGTCTTGTCCCCTGGG + Intergenic
1101700836 12:107172310-107172332 TCACGCAACCTCTGCCTCCTGGG + Intergenic
1102272376 12:111548792-111548814 TCTCGCAATCTCTGCCTCCCGGG + Intronic
1102351763 12:112197909-112197931 TCTAGCAACCTCTGCCTCCTGGG + Intronic
1102367312 12:112349311-112349333 TCACTCAACCTCTGCCTCCTGGG - Intronic
1102529614 12:113536713-113536735 TCTCCCATCTGCTGCTTCCTGGG - Intergenic
1102962255 12:117100278-117100300 TGTCCCAAATGCAGCCTCCTGGG - Intergenic
1103177234 12:118875152-118875174 TCTCTCAAGCTCTGCCTTCAGGG - Intergenic
1103627856 12:122234365-122234387 CCTCCCAGGCTCAGCCTCCTGGG + Intronic
1103637715 12:122321592-122321614 TCCTGCAACTTCTGCCTCCTGGG + Intronic
1103651100 12:122433217-122433239 TCACGCAACTTCTGCTTCCTGGG - Intergenic
1103725721 12:122996564-122996586 TCTCCCAAGGTCTGCCTGATTGG - Exonic
1104716887 12:131021617-131021639 TCTCCCAAGGCCTCTCTCCTCGG + Intronic
1104725474 12:131072908-131072930 TCTCCCCAGTGCTGGCTCCTGGG - Intronic
1104742732 12:131190205-131190227 ACTCCCAAGTGCAGCCTGCTGGG + Intergenic
1105332064 13:19427158-19427180 ACTGCCAACTTCTGCCTCCCAGG + Intronic
1105974799 13:25464126-25464148 TCTGCCAGATTCAGCCTCCTGGG + Intronic
1106396954 13:29390575-29390597 TCACTCAGCTTCTGCCTCCTGGG - Intronic
1107505226 13:41027055-41027077 TGCCCTAAGTTCTGCCTACTGGG - Intronic
1107684681 13:42885300-42885322 TCACTCAACCTCTGCCTCCTGGG - Intergenic
1107687000 13:42911448-42911470 TTATCCAAGTTCAGCCTCCTGGG + Intronic
1108429400 13:50339044-50339066 TCTCCCAACTTCTGTTTCCCTGG + Intronic
1110584285 13:77170382-77170404 TCTCCCAAATACTGATTCCTAGG + Intronic
1111557784 13:89904609-89904631 TATCACAACCTCTGCCTCCTGGG + Intergenic
1111940321 13:94600901-94600923 ACTCCCAAGTTCTCCCTTCTAGG - Intergenic
1112199535 13:97261587-97261609 TCGCTGAAGTTGTGCCTCCTGGG + Intronic
1112487852 13:99835926-99835948 TCTTCCAAGTCCTGGCCCCTGGG - Intronic
1112774755 13:102831967-102831989 TTTTGCAAGTTCTGCCTCCCGGG - Intronic
1113849685 13:113410934-113410956 TCTGAGAAGTTCAGCCTCCTGGG - Intergenic
1114127953 14:19752593-19752615 TCTCCAAAGTTCTGCCCACAGGG - Intronic
1114213138 14:20632993-20633015 TCTCTCCAGTTCTGGCTCGTTGG + Intergenic
1115027186 14:28759206-28759228 TGTCCCAACTTGGGCCTCCTGGG - Intergenic
1115224813 14:31091388-31091410 TCACCTAAGTTCTGGCTTCTGGG + Intronic
1115273799 14:31584198-31584220 GCACCCAACTTCTGCCTCCCGGG + Intronic
1116292452 14:43060736-43060758 GCTCACAAGCTCCGCCTCCTAGG - Intergenic
1116839997 14:49810290-49810312 TCATGCAAGCTCTGCCTCCTGGG - Intronic
1117130658 14:52683130-52683152 ACTGCCAACTTCCGCCTCCTGGG - Intronic
1118519197 14:66562174-66562196 TCTCCTAAGTTCTGTCTCTGGGG + Intronic
1119430568 14:74565648-74565670 TCTCCCAAGTTCTGCCTCCTGGG - Intronic
1119563161 14:75606834-75606856 TCCCCCAACCTCAGCCTCCTGGG - Intronic
1119882196 14:78109058-78109080 TCTCCTAAGTACTGCCTCAGTGG + Intergenic
1120101309 14:80448930-80448952 ACTGCCAAGTTCCGCCTCCCAGG + Intergenic
1120563341 14:86023925-86023947 TCTCTCAAGTCATGGCTCCTTGG - Intergenic
1121770449 14:96531075-96531097 TCACTGCAGTTCTGCCTCCTGGG + Intronic
1122152392 14:99732058-99732080 CCTCCCAGGTTCAGGCTCCTGGG - Intergenic
1122480364 14:102043205-102043227 ACTGCCAACCTCTGCCTCCTGGG - Intronic
1122665938 14:103329579-103329601 TCTTGCAACCTCTGCCTCCTGGG - Intergenic
1122953617 14:105059968-105059990 TCTCCAAAGTGATGCCCCCTTGG + Intronic
1123476417 15:20594859-20594881 TCTGCCAGGTTCTGCCTACAAGG + Intergenic
1123641594 15:22405505-22405527 TCTGCCAGGTTCTGCCTACAAGG - Intergenic
1124042233 15:26116195-26116217 TCTCCCAAATTCTGTCTGCAGGG - Intergenic
1125184954 15:36919500-36919522 TCCCACAACTTCTGCCTCCCGGG - Intronic
1125648239 15:41291548-41291570 ACTTGCAAGCTCTGCCTCCTGGG + Intergenic
1126075818 15:44908246-44908268 TCCCCCTACTTCAGCCTCCTGGG + Intergenic
1126077055 15:44921649-44921671 CCTCTCAACTTCTACCTCCTGGG - Intergenic
1126083739 15:44990312-44990334 CATCCCAAGCTCTGCCTCCCAGG - Intergenic
1127411357 15:58710201-58710223 TCACGCAACCTCTGCCTCCTGGG - Intronic
1127719354 15:61684577-61684599 TCTCCCAAGACCTCTCTCCTTGG + Intergenic
1127987959 15:64089437-64089459 GCTCTCAACCTCTGCCTCCTGGG - Intronic
1127998951 15:64172799-64172821 TCCTCCAAGTTCTGCTTCCTGGG + Intronic
1128173911 15:65536679-65536701 TCACCCAACTTCAGCCTCCCAGG - Intronic
1128961685 15:72013079-72013101 TGTCTCAAGATCTGCCTCCCAGG - Intronic
1129208248 15:74050116-74050138 TGTCCCATGCTCTCCCTCCTGGG - Intergenic
1130132615 15:81156939-81156961 TATCCCAAGTTATGTCTCCAGGG + Intergenic
1130970332 15:88727236-88727258 TCTTGCAAGCTCCGCCTCCTGGG - Intergenic
1131644425 15:94326641-94326663 TCCTACAACTTCTGCCTCCTGGG + Intronic
1132585194 16:703132-703154 TCTGCCCTGTTCTGCCTCATGGG + Intronic
1132593384 16:736606-736628 CCTCCCAGGTTCAGCCTCCTGGG + Intronic
1132666766 16:1084567-1084589 ACTCCCCAGTTCTCCCTCCCAGG + Intergenic
1132666778 16:1084599-1084621 ACTCCCCAGTTCTCCCTCCCGGG + Intergenic
1132783325 16:1640836-1640858 CCTCCCAAGAGCTCCCTCCTAGG - Intronic
1132873462 16:2125560-2125582 TCTCCCTCGTTCAGCCTCCGAGG - Intronic
1133047553 16:3097373-3097395 TCTCCCAACCTCAGCCACCTGGG + Intronic
1133159241 16:3898807-3898829 TCTCGCAACCTCTGCCTCCCGGG - Intergenic
1133333120 16:4988375-4988397 TCTGCCAAGCCCTCCCTCCTGGG + Intronic
1133349688 16:5093270-5093292 TCTCCCTCACTCTGCCTCCTGGG - Intronic
1133540355 16:6746568-6746590 TCCCCCCAGTTCAGCCTCCCAGG - Intronic
1134389852 16:13809293-13809315 TCTCCCTAGTTCTGGTTGCTGGG - Intergenic
1134552549 16:15144739-15144761 TCTCCCTCGTTCAGCCTCCGAGG - Intergenic
1135155960 16:20052719-20052741 TCTCCCAAGCTCCGCCTCCCCGG - Intronic
1135598758 16:23763714-23763736 CCTCTCAAGTTTTGTCTCCTTGG - Intergenic
1136235816 16:28913036-28913058 TACCACAACTTCTGCCTCCTGGG + Intronic
1136528177 16:30846732-30846754 TCTCCACAGGTCTGTCTCCTGGG - Intronic
1136562065 16:31045314-31045336 ACTGCCAACCTCTGCCTCCTGGG - Intergenic
1137573031 16:49579057-49579079 TCTCCCACCCTCTGCATCCTGGG - Intronic
1137680714 16:50342494-50342516 TGTCGCAAGCTCTGCCTCCTGGG + Intronic
1138214170 16:55188713-55188735 TTTCCCAAGTTAAGGCTCCTCGG - Intergenic
1138417767 16:56881031-56881053 CCTCGCGAGTTCTGCCTCCATGG - Intronic
1138502137 16:57453378-57453400 TCTCCAAAGTGGTGCCTTCTTGG - Intronic
1139622679 16:68159496-68159518 TCACGCAAGCTCCGCCTCCTGGG + Intronic
1139697268 16:68684121-68684143 TCTTCCCACTTCAGCCTCCTGGG - Intronic
1139805507 16:69562436-69562458 TCACTCAACCTCTGCCTCCTGGG + Intergenic
1140226221 16:73079447-73079469 TGTCCCAACCTCTGCCTCCTGGG - Intergenic
1140309662 16:73836898-73836920 CCTCTCATCTTCTGCCTCCTTGG + Intergenic
1140612144 16:76613131-76613153 TCACGCAACCTCTGCCTCCTGGG + Intronic
1140854814 16:78968653-78968675 TCTCCCGATATCAGCCTCCTTGG - Intronic
1140877145 16:79163185-79163207 CCTCCCAATCTCTCCCTCCTAGG - Intronic
1140892710 16:79298723-79298745 TCACCCAAGTTCAGCCCCCAAGG - Intergenic
1141532172 16:84654065-84654087 TTTCCCCAGTCCTGCCCCCTGGG + Intronic
1141772794 16:86101313-86101335 GCCCCCTAGTCCTGCCTCCTCGG + Intergenic
1141954001 16:87357855-87357877 TGTCACAACCTCTGCCTCCTCGG - Intronic
1142713946 17:1737970-1737992 TCTCCCCAGCTCTGCCCTCTGGG + Exonic
1142873890 17:2839225-2839247 TCACTCAACCTCTGCCTCCTGGG - Intronic
1143335002 17:6165492-6165514 TATCCCTTGTTCTGCCTCCTGGG - Intergenic
1144282904 17:13744711-13744733 TCTCCCAAGGTCTCTCTCCTGGG + Intergenic
1144518718 17:15939783-15939805 TCACGCAAGCTCCGCCTCCTGGG - Intergenic
1144520561 17:15949917-15949939 TTTCCCAAGAGCTCCCTCCTTGG + Intronic
1145193944 17:20870119-20870141 ACTGCCAAGCTCTGCCTCCTGGG + Intronic
1145763530 17:27442067-27442089 CCTCCCAACCTCTGCCTCCCGGG - Intergenic
1146016313 17:29236608-29236630 TCACGCAACCTCTGCCTCCTGGG + Intergenic
1146189657 17:30753620-30753642 ACTGCAAAGTTCTGCCTCCTGGG + Intergenic
1146585587 17:34078876-34078898 TCCCCCAAGTTCTCCTACCTTGG + Intronic
1147466857 17:40617065-40617087 TCTCCAAGGTTCTGACTCCTTGG + Intergenic
1148049459 17:44762248-44762270 ACTTCCCAGTTCTGCCTCCAGGG + Intronic
1148366883 17:47062083-47062105 TCTTACAACCTCTGCCTCCTGGG + Intergenic
1148591709 17:48821113-48821135 ACTGCCAACCTCTGCCTCCTGGG - Intergenic
1150259278 17:63774717-63774739 TCTCCCAAGCGCTGCCTCCTTGG - Intronic
1150343800 17:64388740-64388762 TCACCGAACCTCTGCCTCCTGGG + Intronic
1150812408 17:68367268-68367290 GCTCCCAGGGTCTGCCGCCTGGG - Intronic
1151247964 17:72809986-72810008 TATTGCAACTTCTGCCTCCTGGG - Intronic
1151670974 17:75571573-75571595 ACTCCCAGGTTTTCCCTCCTGGG - Intronic
1152310230 17:79545473-79545495 TCTCCCCACTTCGGCCACCTTGG + Intergenic
1152319716 17:79601683-79601705 TCTCCCAAAGTCAGTCTCCTTGG + Intergenic
1152431423 17:80250177-80250199 TCCCCCACGTTCTGCCATCTAGG - Intronic
1152493567 17:80654297-80654319 TTTCCCGATTTCTGCCTCCATGG - Intronic
1152668402 17:81585911-81585933 TGTTGCAACTTCTGCCTCCTGGG - Intronic
1153076902 18:1173186-1173208 TGTCCCAAATTCTGGATCCTGGG - Intergenic
1153207102 18:2715608-2715630 TCTTCCCACTTCAGCCTCCTGGG - Intronic
1153215185 18:2813593-2813615 TCTCCCCAGCTTTTCCTCCTAGG - Intergenic
1153244213 18:3057666-3057688 TCTCCCAGGGCCTCCCTCCTCGG + Intergenic
1153292509 18:3515392-3515414 TCACTCAAGCTCCGCCTCCTGGG - Intronic
1153498943 18:5728851-5728873 TCTCCCAAGCTCAGCCACCATGG + Intergenic
1154506234 18:15043351-15043373 TCTTCAAAGTTCTGCCCACTGGG - Intergenic
1155812184 18:30250831-30250853 TCTCCCTAGTTCTTCCTACAAGG - Intergenic
1156199078 18:34809379-34809401 TCACGCAACCTCTGCCTCCTGGG - Intronic
1156222218 18:35064106-35064128 GCTCACAACCTCTGCCTCCTGGG - Intronic
1156818240 18:41338472-41338494 TTCCCTAAGTTCTGCTTCCTTGG + Intergenic
1157241876 18:46018442-46018464 GCACCCAACTTCTGCCTCCTGGG + Intronic
1157692911 18:49698480-49698502 ACTGCCAAGTTCTGCACCCTGGG + Intergenic
1158283074 18:55849067-55849089 TCACACAACCTCTGCCTCCTGGG - Intergenic
1158513192 18:58109644-58109666 TCACTCAACCTCTGCCTCCTGGG + Intronic
1158564633 18:58544301-58544323 TTTCCAAAGTTCTGCCTCCTAGG + Intronic
1158736452 18:60087313-60087335 CCTCCCAAGTCCAGCCTCTTGGG + Intergenic
1158805941 18:60972682-60972704 TCTCACAAGCTCCGCCTCCCGGG - Intergenic
1158861331 18:61594921-61594943 TCTTCCCACTTCAGCCTCCTGGG - Intergenic
1160227365 18:77021425-77021447 TCGCCCAAGGTCAGCCACCTGGG - Intronic
1160968820 19:1758416-1758438 TCTCCCAAGTCCTACCCCATGGG - Intronic
1161020379 19:2007749-2007771 GCTGCAAAGCTCTGCCTCCTGGG - Intronic
1162074132 19:8173535-8173557 TACTGCAAGTTCTGCCTCCTGGG + Intronic
1162129358 19:8516175-8516197 TCTTGCAAGCTCCGCCTCCTGGG + Intergenic
1162282595 19:9711141-9711163 TCCTGCAACTTCTGCCTCCTGGG - Intergenic
1162580850 19:11529316-11529338 ACTCCCAAGTCCAGCCTCCCGGG - Intergenic
1163350182 19:16771869-16771891 TCACCCAACTTCTGCCTCCTGGG + Intronic
1163822250 19:19502632-19502654 CTTCCCAAGCTCAGCCTCCTCGG + Intronic
1163977267 19:20864111-20864133 TCACACAACCTCTGCCTCCTGGG - Intergenic
1164565609 19:29323845-29323867 TGTCCCCATTCCTGCCTCCTGGG + Intergenic
1164803079 19:31093674-31093696 TCTCCCCAGTTCTCCATCCACGG + Intergenic
1164979273 19:32601221-32601243 TCACGCAACCTCTGCCTCCTGGG - Intronic
1165129883 19:33625159-33625181 TGCCACAAGCTCTGCCTCCTGGG + Intronic
1165682484 19:37789702-37789724 CCTCCCGGGTTCTGCCTCCCGGG - Intronic
1165819805 19:38667240-38667262 TCACCCTAGGTTTGCCTCCTTGG - Intronic
1165830293 19:38727319-38727341 GGTCCCAAGTCCTGCCTTCTGGG + Intronic
1165939519 19:39408157-39408179 TGTCACAAGTTCTACCTCCAGGG + Exonic
1166531011 19:43543582-43543604 TCTCCCATTCTCTGCCTCTTTGG + Intronic
1166860846 19:45810244-45810266 ACTGCCAAGCTCCGCCTCCTGGG + Intronic
1167030758 19:46958306-46958328 ACTGCCAAGCTCCGCCTCCTGGG - Intronic
1167467692 19:49658711-49658733 TCTCCCATCCTCAGCCTCCTGGG - Intergenic
1168275110 19:55273635-55273657 TCCCCCAAATACTGCCGCCTGGG - Intronic
1168374888 19:55868576-55868598 TATCGCAACCTCTGCCTCCTGGG + Intronic
925237155 2:2289916-2289938 TCTCCTGGGATCTGCCTCCTGGG - Intronic
925361808 2:3285197-3285219 TGTCCCAGGTTCTTCCTCTTGGG - Intronic
925460787 2:4060909-4060931 TGCTCCAAGTTCTGCCTACTGGG - Intergenic
925918342 2:8623135-8623157 TCTCTGCAGTTCTGCCTCCCGGG + Intergenic
926035721 2:9633957-9633979 CCTCCCATGTTCAGCCTCCCGGG - Intergenic
926201057 2:10798108-10798130 TCTTGCAACCTCTGCCTCCTGGG - Intronic
926293174 2:11547018-11547040 TCACGCAATCTCTGCCTCCTGGG + Intronic
927050313 2:19321543-19321565 TCACTCAAGCTCTGCCTCCCGGG - Intergenic
927099344 2:19775918-19775940 AATCCCAAGTACTTCCTCCTAGG - Intergenic
927644164 2:24865367-24865389 ACTCACAACTTCCGCCTCCTGGG - Intronic
927869484 2:26614533-26614555 TCTGCCAGACTCTGCCTCCTGGG - Intronic
928324674 2:30310042-30310064 ACTCACAACTTCTGCCTCCTAGG + Intronic
928692848 2:33818964-33818986 CCTCCCAAATCCTCCCTCCTGGG + Intergenic
929979941 2:46668934-46668956 TCCCTGAGGTTCTGCCTCCTAGG + Intergenic
930655909 2:54007047-54007069 CCTCCTAGGTTCCGCCTCCTTGG - Intronic
930870700 2:56167884-56167906 TCTCAAAGCTTCTGCCTCCTTGG + Intergenic
931494537 2:62788288-62788310 TCACCCAACTTCTGCCCACTAGG + Intronic
931529180 2:63193592-63193614 CCTCCCTAGCTCAGCCTCCTGGG + Intronic
932006958 2:67936946-67936968 TACCGCAAGTTCTGCCTCCCAGG - Intergenic
932117467 2:69066369-69066391 TCACTCAACCTCTGCCTCCTGGG + Intronic
932262109 2:70335753-70335775 TCATGCAAGCTCTGCCTCCTGGG + Intergenic
932612391 2:73209578-73209600 TCCTCCCAGCTCTGCCTCCTTGG + Intronic
932997833 2:76878796-76878818 CTTCACAAGTTCCGCCTCCTGGG - Intronic
935322467 2:101902327-101902349 TCTCCCAAGACCTCTCTCCTTGG - Intergenic
935329118 2:101963342-101963364 TCTCCCCAGTCCTGGCTCCCGGG + Intergenic
935485709 2:103650868-103650890 TACCGCAACTTCTGCCTCCTGGG - Intergenic
936150785 2:110021035-110021057 TCTCCCAAGGCCTCTCTCCTTGG - Intergenic
936193891 2:110350334-110350356 TCTCCCAAGGCCTCTCTCCTTGG + Intergenic
936512556 2:113159870-113159892 TCCTGCAACTTCTGCCTCCTGGG - Intronic
937248880 2:120511151-120511173 TCTCCAAAGTTGAGTCTCCTTGG + Intergenic
937986486 2:127640421-127640443 TCTCCCAGGCCCTGCCTCCCAGG + Intronic
938037371 2:128046405-128046427 TCACCCAACCTCTGCCTCCCAGG + Intergenic
938392366 2:130916069-130916091 TCTCCCAAGCTCTGCGGCCTGGG - Intronic
938505371 2:131874872-131874894 TATCACAACTTCCGCCTCCTGGG + Intergenic
938579610 2:132634336-132634358 TCTCTAAAGTTCAGGCTCCTCGG - Intronic
938770179 2:134494974-134494996 CCTCCCAGGTTCTCCCTCCCAGG + Intronic
938999855 2:136721749-136721771 TCCTGCAAGCTCTGCCTCCTGGG + Intergenic
939991489 2:148880194-148880216 TATCGCAACCTCTGCCTCCTGGG + Intronic
942518231 2:176775721-176775743 ACTGCCAACCTCTGCCTCCTGGG + Intergenic
942853629 2:180520462-180520484 TCTCCACAGGTCAGCCTCCTGGG - Intergenic
944767023 2:202874088-202874110 GCTTGCAACTTCTGCCTCCTGGG - Intergenic
944842627 2:203638960-203638982 TCACTCAACCTCTGCCTCCTGGG + Intergenic
945693747 2:213076825-213076847 TCACGCAAGCTCCGCCTCCTGGG - Intronic
946504195 2:220281476-220281498 TCTCCCAAGGGAGGCCTCCTGGG + Intergenic
946723447 2:222636329-222636351 TGCGCCAAGCTCTGCCTCCTGGG - Intronic
947140218 2:227013583-227013605 TCTCCCAAGGCCTCCCTCCGTGG - Intronic
947155323 2:227156321-227156343 TCACGCAACCTCTGCCTCCTAGG - Intronic
947751743 2:232536155-232536177 TCTCCCAATTCCTGCAGCCTTGG - Intronic
947797520 2:232904302-232904324 TTTCTCTAGCTCTGCCTCCTGGG + Intronic
947804132 2:232953224-232953246 CCTTGCAACTTCTGCCTCCTGGG - Intronic
947922734 2:233892451-233892473 TCTTCCAAGTCCTCTCTCCTTGG + Intergenic
948106072 2:235414708-235414730 TCTTCCCAGTTCTGTCTGCTTGG - Intergenic
948391608 2:237615377-237615399 CTCCCCCAGTTCTGCCTCCTTGG - Intergenic
948436732 2:237958818-237958840 TCTCCCAAGGCCTCTCTCCTTGG + Intergenic
1169093725 20:2877333-2877355 TCACGCAACTTTTGCCTCCTGGG + Intronic
1169291876 20:4359640-4359662 CTTCCCAAGTCCTGCTTCCTGGG + Intergenic
1169840182 20:9926951-9926973 TCTCCAAAGTTCCCCCTTCTTGG - Intergenic
1170045843 20:12084605-12084627 TCTCCCAACTTCTGACTTCATGG + Intergenic
1170188459 20:13618942-13618964 ACTGCCAACCTCTGCCTCCTGGG + Intronic
1170560826 20:17557033-17557055 TATCCCAACTGCTGCCTCCCTGG + Intronic
1171234262 20:23511423-23511445 TCTCCCAAGCCCTGCCTACTAGG + Intergenic
1171313659 20:24166982-24167004 TCTCCCAGCCTCTGCCTCCCAGG - Intergenic
1171382054 20:24741765-24741787 TCTCTCAGGCTCTGCCTCCCTGG - Intergenic
1171564823 20:26172192-26172214 TCTCCCAAGGCCTATCTCCTTGG + Intergenic
1172007310 20:31826417-31826439 ACTCCCAAGTCATGCCTGCTGGG - Intronic
1173301631 20:41808824-41808846 GCCTCCAAGCTCTGCCTCCTGGG + Intergenic
1173489322 20:43466993-43467015 TCACGCAACTTCTGCCTCCTGGG + Intergenic
1173664720 20:44755792-44755814 TCTCCCCCTTTTTGCCTCCTCGG - Intronic
1173779476 20:45742711-45742733 TTCCTCAAGTTCTGCCTACTGGG + Intergenic
1173865129 20:46308275-46308297 TCCCCCTAGTCCTGCCGCCTCGG + Exonic
1173993236 20:47318899-47318921 CCTCGCATGTTCTGCCTCCGAGG - Intronic
1174269105 20:49353972-49353994 TCCTCCAAGCTCAGCCTCCTAGG - Intergenic
1175822713 20:61918976-61918998 TCTTCCCACTTCAGCCTCCTGGG + Intronic
1175951706 20:62587172-62587194 TCTCCCAGGGTCTGCTTCTTTGG - Intergenic
1176133056 20:63504975-63504997 TTTCCCAAGTCCTGCTACCTTGG + Intergenic
1176791620 21:13325672-13325694 TCTTCAAAGTTCTGCCCACTGGG + Intergenic
1177376125 21:20273021-20273043 TCTCCCCAGTTTTCCCTCCTAGG - Intergenic
1177734331 21:25070118-25070140 TCTCCTGAGTTCTCTCTCCTTGG - Intergenic
1177921201 21:27154669-27154691 TCTTCCAAGATCTCTCTCCTTGG + Intergenic
1177990158 21:28027644-28027666 TCTTCAAAGTTCTGCCCACTGGG - Intergenic
1178019228 21:28390399-28390421 TCTTCTAAGTTCTTTCTCCTTGG + Intergenic
1178322498 21:31616098-31616120 CCTCCTGGGTTCTGCCTCCTGGG + Intergenic
1179306864 21:40162144-40162166 GCTGCCTGGTTCTGCCTCCTGGG - Intronic
1179803991 21:43825852-43825874 TCTCCCAGGTCCTTCCTCCAAGG - Intergenic
1180122390 21:45762566-45762588 CCTTGCAACTTCTGCCTCCTGGG + Intronic
1180688250 22:17687590-17687612 TACTGCAAGTTCTGCCTCCTGGG + Intronic
1181312406 22:21952509-21952531 GCCCCCCAGTTCTGCCCCCTTGG + Intronic
1181569132 22:23757741-23757763 GCTCACAACCTCTGCCTCCTGGG + Intergenic
1181834755 22:25594800-25594822 ACTTGCAAGCTCTGCCTCCTGGG - Intronic
1182071498 22:27466928-27466950 TCTCACGTGTTCTGCCTCTTCGG - Intergenic
1182360216 22:29742067-29742089 TCTCTGAAGTTCTGCCTGCTGGG + Intronic
1182595622 22:31417912-31417934 GCTCACAACCTCTGCCTCCTGGG - Intronic
1182735025 22:32527276-32527298 TCTACCATTTTCTGCCTCCTTGG + Intronic
1183472007 22:38014424-38014446 CATCACAACTTCTGCCTCCTGGG + Intronic
1184076021 22:42178656-42178678 TCTCGCAACCTCTGCCTCCCGGG + Intronic
1184134201 22:42536782-42536804 TCACTCCAGTTCTGCCTCCTGGG - Intergenic
1184563529 22:45277292-45277314 ACTCCAAACCTCTGCCTCCTGGG - Intergenic
1184875771 22:47274537-47274559 TATCCCAAGGTCTGTCTCTTGGG + Intergenic
1184932047 22:47688650-47688672 TCTCGCAATCTCTGCCTCCCAGG + Intergenic
1184940132 22:47758443-47758465 TGTCCCACTTTATGCCTCCTGGG - Intergenic
1185261686 22:49869046-49869068 TCACCCAACCTCCGCCTCCTGGG - Intronic
949932003 3:9086126-9086148 TGTCCCAGGGTCTGCTTCCTGGG + Intronic
950017475 3:9764386-9764408 CATCACAATTTCTGCCTCCTGGG + Intronic
950175407 3:10870029-10870051 TCTGCCTATTTCTGCGTCCTTGG + Intronic
950347939 3:12315779-12315801 TCCACAAAGCTCTGCCTCCTCGG + Intronic
950633765 3:14300987-14301009 TCTCCCAGGCTCAGGCTCCTGGG - Intergenic
950759975 3:15213954-15213976 ACTGCCAAGTTCCGCCTCCGGGG + Intronic
951623227 3:24629588-24629610 TCACCCAAACTCTGCCCCCTGGG - Intergenic
951632715 3:24739100-24739122 GCTCACAAGCTCCGCCTCCTGGG + Intergenic
951715434 3:25639381-25639403 TCACTCAACCTCTGCCTCCTGGG + Intronic
952010854 3:28899589-28899611 GCTCCCATTTTCTGCCCCCTTGG - Intergenic
952494029 3:33900582-33900604 TCTCCTGAGTCCTGCCTCCTGGG + Intergenic
952524031 3:34190939-34190961 TCTCCCAAGGCCTTGCTCCTAGG - Intergenic
953131358 3:40142536-40142558 CCTCGCAACCTCTGCCTCCTGGG + Intronic
953323193 3:41990557-41990579 CTTTCCAACTTCTGCCTCCTGGG - Intergenic
953804830 3:46059376-46059398 TGCTCCAAGTTCTGCCTACTGGG - Intergenic
953948989 3:47173524-47173546 TCACTCAACCTCTGCCTCCTGGG - Intergenic
954165608 3:48755070-48755092 TCACGCAAGCTCTGCCTCCCGGG + Intronic
955046762 3:55368265-55368287 TCTTCCAAGTTGTGGGTCCTGGG + Intergenic
955466308 3:59240682-59240704 TCCCACAACCTCTGCCTCCTGGG - Intergenic
955807877 3:62756126-62756148 TCACTCAACCTCTGCCTCCTGGG + Intronic
956078127 3:65527837-65527859 TCTCGCAACCTCTGCCTCCTGGG - Intronic
956516357 3:70052788-70052810 TCTCCCAACCTCTAACTCCTAGG - Intergenic
956863481 3:73347503-73347525 ACTCACAACCTCTGCCTCCTGGG + Intergenic
957053992 3:75430618-75430640 TCTCCCTCACTCTGCCTCCTGGG - Intergenic
958614281 3:96471119-96471141 TCACGCAAGCTCCGCCTCCTGGG - Intergenic
959083185 3:101824013-101824035 TCTGCAACCTTCTGCCTCCTGGG - Exonic
959286031 3:104412372-104412394 TCTCCCAAGGTCTTTATCCTTGG - Intergenic
959596230 3:108131728-108131750 TCTCCCAAGTTAGCCCTCCCCGG + Intergenic
959677219 3:109050060-109050082 TCTCCTGAGTTCTTCCTGCTTGG - Intronic
961300845 3:125921097-125921119 TCTCCCTCACTCTGCCTCCTGGG + Intergenic
961538739 3:127586432-127586454 CTTCCCAAGTTCAGCCTTCTGGG + Intronic
961858787 3:129897427-129897449 TCTTCAAAGTTCTGCCAACTGGG + Intergenic
962202137 3:133409910-133409932 TCTCCCCAGTGCAGCCTCCTTGG - Intronic
963067584 3:141275486-141275508 TCTACCAAGTCCTGGCCCCTTGG - Intronic
964026175 3:152077726-152077748 CCATCCAAGTTCTGTCTCCTTGG - Intergenic
964745562 3:160008891-160008913 TCACACAACCTCTGCCTCCTCGG - Intergenic
965395561 3:168157082-168157104 TCTCCCTATTTCTTCCTCATAGG + Intergenic
967025131 3:185557934-185557956 CCTCCCAACCTCTACCTCCTGGG - Intergenic
967133582 3:186494564-186494586 CCTCTCAACTTCTGCCTCCCGGG - Intergenic
967157877 3:186710129-186710151 TCACTGAAGTTCTGCCTCCCGGG - Intergenic
967204138 3:187103983-187104005 TCACTCAAGCTCTGCCTCCTGGG + Intergenic
967255681 3:187589480-187589502 TACCACAAGCTCTGCCTCCTGGG - Intergenic
968154073 3:196363851-196363873 TCTGGCAACTTCTGCCTCCCGGG - Intronic
968544321 4:1189911-1189933 ACTTACAAGCTCTGCCTCCTGGG - Intronic
968715725 4:2158025-2158047 TGCCGCAACTTCTGCCTCCTGGG + Intronic
968931928 4:3585253-3585275 ACTGCCAAGCTCTGCCTCCTGGG + Intronic
968996795 4:3950925-3950947 TCTCCCTCACTCTGCCTCCTGGG - Intergenic
969050000 4:4365974-4365996 TCTACCGAGTTTTGCCCCCTTGG - Intronic
969372089 4:6739063-6739085 TCACTCAACCTCTGCCTCCTGGG + Intergenic
969563576 4:7964677-7964699 TCACCCATGATCTCCCTCCTGGG - Intergenic
969717216 4:8873532-8873554 TCTCCCAAGCCCTGCTCCCTGGG + Intergenic
969817164 4:9695316-9695338 TCTCCCTCACTCTGCCTCCTGGG + Intergenic
969850186 4:9949970-9949992 CCTCCCAACAACTGCCTCCTGGG + Intronic
970938438 4:21602297-21602319 TCTCCCAAATTAGACCTCCTTGG + Intronic
970983944 4:22133564-22133586 TATCCCAAATTCTGCCTCAATGG + Intergenic
971128443 4:23779623-23779645 TCTCCCAATTTCTGCTTTCCAGG - Intronic
972764721 4:42141977-42141999 TCACCGAACCTCTGCCTCCTGGG + Intronic
972919582 4:43921501-43921523 TGGCGCAAGCTCTGCCTCCTGGG - Intergenic
973103871 4:46306406-46306428 TCTGCTAATTTCTGCATCCTTGG - Intronic
977035355 4:91944147-91944169 ACTGCCAACTTCTGCCTCCTGGG - Intergenic
977274215 4:94955702-94955724 TCACTGAAGCTCTGCCTCCTGGG + Intronic
977764350 4:100778931-100778953 TCTCCCATGTTCTCCTCCCTGGG + Intronic
977824706 4:101517277-101517299 TCTCCCAACATCTTCCTTCTTGG + Intronic
978477272 4:109145141-109145163 TCCTGCAAGCTCTGCCTCCTGGG + Intronic
978568448 4:110110513-110110535 TCTTCCCACTTCAGCCTCCTGGG + Intronic
979179711 4:117709415-117709437 TCTCACAACTTCTGCCTCTTGGG - Intergenic
980283843 4:130756882-130756904 TGCCCCAAGTTCTGCCAACTGGG - Intergenic
980443950 4:132883264-132883286 TCTTCCAATCCCTGCCTCCTAGG + Intergenic
980733604 4:136853329-136853351 GCTCACAAGCTCTGCCTCCCAGG + Intergenic
982050719 4:151498737-151498759 ACTGCCAAGCTCTGCCTCCTGGG - Intronic
982154027 4:152497245-152497267 TCACACAAATTCTGCCTCCCGGG - Intronic
983221698 4:165049973-165049995 TCTGCCAAGTTCTGCATCCCGGG - Intergenic
983331853 4:166340293-166340315 TCACACAAGCTCTGCCTCCCAGG + Intergenic
984699501 4:182809565-182809587 CCTCACCAGTTCTCCCTCCTGGG + Intergenic
984986392 4:185334260-185334282 TCACGCAACTTCTGCCTCCCGGG - Intronic
985039958 4:185880107-185880129 TCTGTCTAGTTCTGCCTCCCAGG + Intronic
985645730 5:1083942-1083964 CCGCCCAGGGTCTGCCTCCTGGG - Exonic
985855005 5:2417695-2417717 AGTTCCAAGTTCTGTCTCCTGGG + Intergenic
985861872 5:2477761-2477783 TCTCGCAGGTACTTCCTCCTGGG + Intergenic
986201563 5:5583958-5583980 TCTCCCATTTTCTGACTTCTTGG - Intergenic
986297815 5:6454282-6454304 TCTCCTGAGTCCTGCCTGCTTGG + Intronic
986640049 5:9863345-9863367 ACTGCAAAGCTCTGCCTCCTGGG + Intergenic
986669673 5:10131755-10131777 CATCCCAACCTCTGCCTCCTGGG - Intergenic
988334357 5:29886743-29886765 TCCCCCAAATTCTGTATCCTAGG - Intergenic
989050436 5:37314762-37314784 TCGCCCAGGCTCCGCCTCCTGGG - Intronic
989262067 5:39429598-39429620 TCACTCAAGCTCTGCCTCCCGGG + Intronic
989963781 5:50445350-50445372 TGCCGCAAGCTCTGCCTCCTGGG - Intergenic
990207163 5:53442015-53442037 TTTACCAAGTTCTCCCTCCAAGG + Intergenic
990984131 5:61626191-61626213 GCTGCCCAGCTCTGCCTCCTCGG - Intergenic
991055386 5:62314482-62314504 TTTCCCATGCTCTGCTTCCTTGG - Intronic
991074217 5:62517120-62517142 TACTGCAAGTTCTGCCTCCTGGG - Intronic
992780225 5:80120737-80120759 TCACGCAACCTCTGCCTCCTGGG - Intronic
992820987 5:80495752-80495774 TACCGCAAGCTCTGCCTCCTGGG - Intronic
993174079 5:84459957-84459979 GCTCACAATCTCTGCCTCCTGGG + Intergenic
993331505 5:86605954-86605976 TCTGACAATTTCTGTCTCCTTGG + Intergenic
994740503 5:103611971-103611993 TCGCTCAAGCTCTGCCTCCCGGG + Intergenic
995104645 5:108361617-108361639 TCTCCCAGGCTCTTTCTCCTAGG + Intronic
995170050 5:109097755-109097777 AGTCCCATATTCTGCCTCCTGGG + Intronic
996691874 5:126348756-126348778 TCTGCCCAGTGCAGCCTCCTGGG + Intergenic
996861453 5:128071783-128071805 TCTCAAAATCTCTGCCTCCTGGG + Intergenic
997149926 5:131482408-131482430 TCCTCCCACTTCTGCCTCCTGGG + Intronic
998180447 5:139935089-139935111 ACTGCCAACTTCTGCCTCCTGGG - Intronic
999028551 5:148263550-148263572 ACTGCCAACCTCTGCCTCCTGGG + Intergenic
999843711 5:155455885-155455907 TCACTCAGGTTCTGTCTCCTGGG + Intergenic
999904033 5:156119706-156119728 TCTCCCTGGTTTTGCCTTCTCGG + Intronic
1000002273 5:157150402-157150424 TCTCGCAACTTCCACCTCCTTGG + Intronic
1000754236 5:165136602-165136624 TCTCCCAAGTCCTCTCTCCTTGG + Intergenic
1001576630 5:172768958-172768980 TCTCCCAACTTCAGCTTCATGGG - Exonic
1002102972 5:176866473-176866495 TCTCCCAAGCTGAGCCGCCTGGG + Intronic
1002476207 5:179467837-179467859 GCTCCCACTTTTTGCCTCCTAGG - Intergenic
1003089227 6:3087613-3087635 TGGCGCAAGCTCTGCCTCCTGGG + Intronic
1003136144 6:3435931-3435953 TCTCCTGAGTTCTCTCTCCTTGG - Intronic
1003495126 6:6657108-6657130 TCTCCACAGTTCTTCCACCTCGG + Intergenic
1003668481 6:8133248-8133270 TCCCGCAACCTCTGCCTCCTGGG + Intergenic
1004004025 6:11622700-11622722 TCTCCCAAGGCCTCTCTCCTTGG + Intergenic
1004248470 6:14002618-14002640 GCTCCCGAGTTCTGCCCCGTGGG - Intergenic
1004383104 6:15149221-15149243 TCTTGCAACCTCTGCCTCCTGGG + Intergenic
1005199496 6:23326835-23326857 TCATGCAAGCTCTGCCTCCTGGG - Intergenic
1005637466 6:27765639-27765661 TTTCCCAAGATCTCCATCCTGGG - Intergenic
1006463986 6:34179966-34179988 TCTCCCAATCTCTGCCTCCCAGG - Intergenic
1006662819 6:35662983-35663005 ACTGCCATCTTCTGCCTCCTTGG - Intronic
1008094430 6:47324833-47324855 TCCTGCAAGCTCTGCCTCCTGGG + Intergenic
1008642251 6:53475944-53475966 TCTCCCAAGGCCTCTCTCCTTGG + Intergenic
1009421256 6:63467523-63467545 TCTCCTAAGGCCTGTCTCCTTGG + Intergenic
1010214802 6:73392378-73392400 ACTGCCAACTTCTGCCTCCCAGG + Intronic
1011095604 6:83658531-83658553 GCTCACAAGCTCTGCCTCCTGGG - Intronic
1011407463 6:87030967-87030989 TCTCCCAAGGCCTCTCTCCTTGG + Intergenic
1011675279 6:89727193-89727215 TCCCCCAGGTTCAGACTCCTGGG - Intronic
1011697516 6:89925443-89925465 ACTGCCAAGTTCTGCTCCCTCGG - Intergenic
1012619944 6:101331145-101331167 TCGCGCAAGCTCTGCCTCCCGGG + Intergenic
1013483443 6:110572542-110572564 TACCACAACTTCTGCCTCCTGGG + Intergenic
1013663026 6:112317943-112317965 TACTGCAAGTTCTGCCTCCTGGG + Intergenic
1014221588 6:118803867-118803889 TCTCCCAAGTCCTACCTATTTGG + Intergenic
1014451641 6:121588360-121588382 TCTTCCCATTTCAGCCTCCTGGG + Intergenic
1015258632 6:131209324-131209346 CATTACAAGTTCTGCCTCCTGGG + Intronic
1015335363 6:132031046-132031068 TATCTTAAGTTCTTCCTCCTGGG - Intergenic
1016107562 6:140181340-140181362 TTTCCCCAGTTCTTCCTCCTTGG - Intergenic
1017126148 6:151066359-151066381 ACTTGCAAGCTCTGCCTCCTGGG - Intronic
1017581689 6:155872002-155872024 TATCACAACCTCTGCCTCCTGGG + Intergenic
1017919984 6:158863162-158863184 GCTCGCAAGCTCCGCCTCCTGGG - Intergenic
1020059930 7:5144307-5144329 TCCCCGCAGCTCTGCCTCCTCGG - Intergenic
1020185230 7:5953917-5953939 CACCGCAAGTTCTGCCTCCTGGG + Intronic
1020236828 7:6362345-6362367 TCATGCAAGCTCTGCCTCCTGGG - Intergenic
1020297685 7:6770827-6770849 CACCGCAAGTTCTGCCTCCTGGG - Intronic
1020321081 7:6939309-6939331 TCTCCCTCACTCTGCCTCCTGGG - Intergenic
1020795907 7:12678259-12678281 TCACGCAAGTGCTGCCTCCCGGG - Intergenic
1021048946 7:15958131-15958153 TACTGCAAGTTCTGCCTCCTGGG - Intergenic
1021260272 7:18447914-18447936 TCACTGCAGTTCTGCCTCCTGGG + Intronic
1021571446 7:22069178-22069200 GCGTCCAAGCTCTGCCTCCTGGG - Intergenic
1022001753 7:26232640-26232662 TCTTGCAACCTCTGCCTCCTGGG - Intergenic
1022477770 7:30723021-30723043 TCTGCCCACTTCAGCCTCCTGGG + Intronic
1022886919 7:34655987-34656009 TACTGCAAGTTCTGCCTCCTGGG - Intergenic
1022994298 7:35738554-35738576 TCATGCAAGGTCTGCCTCCTGGG - Intergenic
1023775894 7:43606997-43607019 CATCCCAACTTCTGCCTCCCAGG + Intronic
1023924548 7:44656766-44656788 TCTTCCAGATTCTGCTTCCTGGG + Intronic
1023952935 7:44861902-44861924 TCACTCAATGTCTGCCTCCTGGG + Intergenic
1024931984 7:54673636-54673658 TCCCCCAAGCACTGCTTCCTGGG + Intergenic
1025936223 7:66039830-66039852 TCTCTCTATTTCTTCCTCCTGGG + Intergenic
1026883901 7:73925512-73925534 ACTGCAAAGCTCTGCCTCCTGGG + Intergenic
1026922803 7:74168920-74168942 TCACTCAACCTCTGCCTCCTGGG + Intergenic
1027026778 7:74858425-74858447 ACTTCCAACTTCCGCCTCCTGGG - Intergenic
1027060974 7:75085684-75085706 ACTTCCAACTTCCGCCTCCTGGG + Intergenic
1027340772 7:77205681-77205703 TCACGCAACCTCTGCCTCCTGGG - Intronic
1027845893 7:83374128-83374150 TATCGCAACCTCTGCCTCCTGGG - Intronic
1027922973 7:84419575-84419597 TCCCCCAAGCTTTTCCTCCTAGG - Intronic
1029182866 7:98717086-98717108 CCTCCTGGGTTCTGCCTCCTGGG + Intergenic
1029206549 7:98872397-98872419 TCACTCAAGCTCTGCCTCCTGGG - Intergenic
1029298903 7:99563006-99563028 CATCTCAAGTTCTGCCTGCTTGG - Intronic
1029510132 7:100989182-100989204 CCTCGCAACCTCTGCCTCCTGGG + Intronic
1031058961 7:117027362-117027384 CATCACAACTTCTGCCTCCTGGG - Intronic
1031282995 7:119828469-119828491 TCTCCCAAGTGCCCCCTCCATGG - Intergenic
1031733370 7:125326052-125326074 TCACACAAGTTCCGCCTCCCGGG + Intergenic
1032581097 7:133104164-133104186 TCCCTCAATCTCTGCCTCCTGGG - Intergenic
1033967398 7:146993051-146993073 TCTCCTGCGTTCTGCCTCCTTGG - Intronic
1034045633 7:147924212-147924234 TCACCCAACCTCTGCCTCCTGGG + Intronic
1034324793 7:150220569-150220591 TCTGCCCAGTGCTGCCTCCCCGG + Intergenic
1034438016 7:151072365-151072387 CCCCGCAACTTCTGCCTCCTGGG + Intronic
1034625688 7:152490543-152490565 TATTGCAACTTCTGCCTCCTGGG - Intergenic
1034768398 7:153748662-153748684 TCTGCCCAGTGCTGCCTCCCCGG - Intergenic
1035298524 7:157881411-157881433 TCTCCCAAGGCCTCTCTCCTGGG - Intronic
1037827571 8:22168401-22168423 TGTCCCAATTCCTGCCTCCAAGG - Intronic
1037905334 8:22713022-22713044 TCCCCAAAGTTCTGCTCCCTTGG - Intergenic
1038012255 8:23484504-23484526 TATTGCAACTTCTGCCTCCTGGG + Intergenic
1038822093 8:30961559-30961581 TCTCACACCCTCTGCCTCCTGGG - Intergenic
1039050394 8:33487499-33487521 TACCGCAACTTCTGCCTCCTGGG + Intronic
1039435882 8:37558955-37558977 TCTCCAAAGGTCTGGGTCCTGGG + Intergenic
1039496297 8:37983147-37983169 GCTCCCAAGATCAGCCCCCTAGG + Intergenic
1039998017 8:42551240-42551262 CCCTGCAAGTTCTGCCTCCTGGG - Intronic
1041290994 8:56308348-56308370 GCTCCCAAGTTGGGCCTCCTTGG + Intronic
1041567047 8:59290494-59290516 TCTCCTAAGGCCTGTCTCCTTGG + Intergenic
1042053940 8:64742663-64742685 TCTTCCAAGACCTGGCTCCTTGG + Intronic
1042054017 8:64743549-64743571 TCTTCCAAGAACTGGCTCCTTGG + Intronic
1042100500 8:65271114-65271136 TCTCCCTCGCTCTGCCTGCTAGG - Intergenic
1043085049 8:75819528-75819550 TACTGCAAGTTCTGCCTCCTGGG + Intergenic
1043994014 8:86790585-86790607 GCTCACAAGCTCTGCCTCCCGGG + Intergenic
1044754267 8:95445353-95445375 TCACTCAATTTCTGCCTCCTGGG + Intergenic
1045451878 8:102334820-102334842 CCTTGCAAGCTCTGCCTCCTGGG - Intronic
1046003481 8:108449346-108449368 TCACGCAATCTCTGCCTCCTGGG + Intronic
1046707682 8:117474321-117474343 TCTCTCCAGTTCAGCCTCCTTGG + Intergenic
1046720386 8:117612485-117612507 CCTCCCAACCTCTGCCTCCCAGG + Intergenic
1047410320 8:124619367-124619389 TTTCCCATGCTCTGCCTCCAAGG + Intronic
1047482278 8:125295648-125295670 CATCCCATGTTCTGCCTCATTGG + Intronic
1047482956 8:125302032-125302054 TCACTCAAATTCTGCCTCCCAGG + Intronic
1047989260 8:130268409-130268431 ACTACAAACTTCTGCCTCCTGGG - Intronic
1048760716 8:137791986-137792008 GCTCCCAAGTTCTGCTTTCTTGG + Intergenic
1048815184 8:138326594-138326616 TCTCCCACCTTCTGACTGCTTGG - Intronic
1049322004 8:142001592-142001614 TCTCCCTTGTGCTGCCTCCTGGG + Intergenic
1049723560 8:144133644-144133666 TCACCCAAGCTCCGCCTCCTGGG - Intergenic
1050331891 9:4554221-4554243 TCTCCCAGGCTCTGGCCCCTTGG - Intronic
1051548462 9:18303328-18303350 CCTGACTAGTTCTGCCTCCTGGG - Intergenic
1052125545 9:24770314-24770336 TCTTCAAAGTTCTGCCTTTTGGG + Intergenic
1052460167 9:28752841-28752863 TCTCCCATTTTCTGCCTCTGGGG + Intergenic
1054458205 9:65446676-65446698 ACTGCCAAGCTCCGCCTCCTGGG - Intergenic
1054740725 9:68803557-68803579 TCTCCCAAGTTCATCATCCGTGG + Intronic
1055330049 9:75174263-75174285 TCTCCAAAATTCTGCCGCATGGG + Intergenic
1055364333 9:75527096-75527118 CCTCCCCAGCCCTGCCTCCTAGG - Intergenic
1056151663 9:83796541-83796563 GCTCACAACCTCTGCCTCCTGGG + Intronic
1056336897 9:85580160-85580182 TCACGCAACCTCTGCCTCCTGGG - Intronic
1056499041 9:87189955-87189977 TATTGCAAGTTCTGCCTCCTGGG - Intergenic
1056560170 9:87723072-87723094 ACTCCCATATTCTGCCACCTTGG - Intergenic
1056674043 9:88658093-88658115 TCTCCCAGGCTGTGCCTCTTGGG - Intergenic
1057606316 9:96499879-96499901 TCTCCCAAGGCCTCTCTCCTGGG - Intronic
1058042105 9:100313766-100313788 ACTGCCAACCTCTGCCTCCTGGG - Intronic
1059079221 9:111230510-111230532 TCTCCCCAGTTCTCCCACCTGGG - Intergenic
1059615986 9:115951038-115951060 TCTCTCAAGTTTTACCTTCTTGG - Intergenic
1059935320 9:119304530-119304552 TCTCTCAAGGCCTTCCTCCTGGG - Intronic
1060092167 9:120752956-120752978 CCTCCCAAACTCCGCCTCCTGGG + Intronic
1060535594 9:124384642-124384664 TCTTGCAGGTTCTGGCTCCTTGG - Exonic
1060964376 9:127704431-127704453 GCTCGCAACCTCTGCCTCCTGGG - Intronic
1061571616 9:131481232-131481254 ACTGCCAAGCTCTGCCTCCCGGG - Intronic
1061683568 9:132257078-132257100 ACTCCCAGGTTCCGCCTCCCAGG - Intergenic
1062067021 9:134534046-134534068 TCTCCCAAGGTGTGACTCCATGG + Intergenic
1186390857 X:9157688-9157710 TCGCCCAGGCTCCGCCTCCTGGG + Intronic
1186492302 X:9983583-9983605 TCTCCCAAGAACTTCCTCCTCGG + Intergenic
1186966450 X:14791360-14791382 TCTCCCAATTTCTAGTTCCTTGG - Intergenic
1187092352 X:16110001-16110023 ACTTCCTAGTTCTTCCTCCTTGG - Intergenic
1188453124 X:30330293-30330315 AATGGCAAGTTCTGCCTCCTGGG - Intergenic
1189048705 X:37620697-37620719 TGTCCCCATTTCTGCTTCCTGGG - Intronic
1189402828 X:40688139-40688161 CCTCCCAACCTCTGCCTCCTAGG - Intronic
1189845099 X:45128668-45128690 CCACCCAAGTTCTCCCTGCTAGG - Intergenic
1190111625 X:47593342-47593364 TCACTCAACCTCTGCCTCCTGGG + Intronic
1190762534 X:53448603-53448625 TCTGCCCACCTCTGCCTCCTGGG - Intergenic
1190778325 X:53573344-53573366 TCCCGCAATCTCTGCCTCCTGGG + Intronic
1190778331 X:53573377-53573399 TCCCGCAATCTCTGCCTCCTGGG + Intronic
1190854610 X:54281407-54281429 TCACACAACCTCTGCCTCCTGGG - Intronic
1191755861 X:64591670-64591692 TCTACCAAGTTCTAAATCCTGGG + Intergenic
1192301820 X:69912841-69912863 TCACGCAACTTCTGCCTCCCAGG + Intronic
1192398075 X:70804998-70805020 TCTCCCTATTCCTGCCTTCTTGG + Intronic
1194060894 X:89196299-89196321 GCTCTCAACTTCTGCCTCCCTGG - Intergenic
1194852626 X:98888353-98888375 CCTTGCAAGCTCTGCCTCCTGGG + Intergenic
1195253438 X:103070486-103070508 TCACTCAAGTTCCGCCTCCTGGG - Intergenic
1195292767 X:103445000-103445022 TTTCCCCAGTTCTGCCCCATTGG + Intergenic
1195367232 X:104138329-104138351 TTTCACAACCTCTGCCTCCTGGG - Intronic
1195645435 X:107226062-107226084 TCTCCTAAGAGCTGCCTCATGGG - Intronic
1195757697 X:108215646-108215668 TCTCCCATGCCCTCCCTCCTTGG + Intronic
1196552431 X:117045161-117045183 AAACCCAAGTTCTGACTCCTGGG - Intergenic
1196696937 X:118623334-118623356 CCTCCTAAGTTCTACCTCCTAGG - Intronic
1197907875 X:131445598-131445620 TCCTGCAACTTCTGCCTCCTGGG + Intergenic
1197937419 X:131753710-131753732 TCCCTCAACCTCTGCCTCCTGGG - Intergenic
1197988923 X:132296260-132296282 TTTTTCAAGTTCTGCCTACTGGG + Intergenic
1198569971 X:137944495-137944517 TCTTCCCACTTCAGCCTCCTGGG - Intergenic
1199643175 X:149882415-149882437 CCTCCTTACTTCTGCCTCCTGGG + Intronic
1199693789 X:150329079-150329101 TCTCTCAATTTCTAGCTCCTAGG + Intergenic
1200129233 X:153831871-153831893 TGTCTCAAGTTCTGCTTTCTGGG - Intergenic