ID: 1119430569

View in Genome Browser
Species Human (GRCh38)
Location 14:74565649-74565671
Sequence CTCTCCCAAGTTCTGCCTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 634
Summary {0: 1, 1: 0, 2: 4, 3: 75, 4: 554}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119430569_1119430578 13 Left 1119430569 14:74565649-74565671 CCAGGAGGCAGAACTTGGGAGAG 0: 1
1: 0
2: 4
3: 75
4: 554
Right 1119430578 14:74565685-74565707 TAGACACAGTTGGGGCTGGGAGG 0: 1
1: 0
2: 5
3: 32
4: 294
1119430569_1119430575 5 Left 1119430569 14:74565649-74565671 CCAGGAGGCAGAACTTGGGAGAG 0: 1
1: 0
2: 4
3: 75
4: 554
Right 1119430575 14:74565677-74565699 TGGGGCTGTAGACACAGTTGGGG 0: 1
1: 0
2: 1
3: 16
4: 228
1119430569_1119430576 9 Left 1119430569 14:74565649-74565671 CCAGGAGGCAGAACTTGGGAGAG 0: 1
1: 0
2: 4
3: 75
4: 554
Right 1119430576 14:74565681-74565703 GCTGTAGACACAGTTGGGGCTGG 0: 1
1: 0
2: 0
3: 20
4: 198
1119430569_1119430573 3 Left 1119430569 14:74565649-74565671 CCAGGAGGCAGAACTTGGGAGAG 0: 1
1: 0
2: 4
3: 75
4: 554
Right 1119430573 14:74565675-74565697 TTTGGGGCTGTAGACACAGTTGG 0: 1
1: 0
2: 2
3: 22
4: 164
1119430569_1119430577 10 Left 1119430569 14:74565649-74565671 CCAGGAGGCAGAACTTGGGAGAG 0: 1
1: 0
2: 4
3: 75
4: 554
Right 1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG 0: 1
1: 0
2: 0
3: 26
4: 217
1119430569_1119430579 16 Left 1119430569 14:74565649-74565671 CCAGGAGGCAGAACTTGGGAGAG 0: 1
1: 0
2: 4
3: 75
4: 554
Right 1119430579 14:74565688-74565710 ACACAGTTGGGGCTGGGAGGAGG 0: 1
1: 0
2: 5
3: 51
4: 729
1119430569_1119430574 4 Left 1119430569 14:74565649-74565671 CCAGGAGGCAGAACTTGGGAGAG 0: 1
1: 0
2: 4
3: 75
4: 554
Right 1119430574 14:74565676-74565698 TTGGGGCTGTAGACACAGTTGGG 0: 1
1: 0
2: 1
3: 18
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119430569 Original CRISPR CTCTCCCAAGTTCTGCCTCC TGG (reversed) Intronic
900350098 1:2230217-2230239 CTCACCCAAGCTCTGTCTCCTGG - Intronic
901700634 1:11043326-11043348 CTTTCTCAAGGTCTGGCTCCTGG - Exonic
901808738 1:11753752-11753774 CCCTCCCACGTCCTCCCTCCTGG - Intronic
902057681 1:13615789-13615811 ATCTTCCAAGTTCTGACACCTGG - Intronic
902230352 1:15023562-15023584 CCCCCCCAAGATCTGTCTCCAGG - Intronic
902338210 1:15765874-15765896 CTCTCCCAGTGCCTGCCTCCCGG - Intronic
902350088 1:15847877-15847899 CTCCCCCAGGTTCTGACTCTCGG - Exonic
902517452 1:16996990-16997012 CTCTCTCAAGCCCAGCCTCCCGG + Intronic
902878417 1:19354835-19354857 CTCTCCCACATCCTGCCACCTGG - Intronic
902952565 1:19898021-19898043 CTCACCCAACCTCCGCCTCCCGG + Intronic
903375294 1:22862048-22862070 CTCTCCCAGCTTCAGCCTGCTGG - Intronic
904070120 1:27788935-27788957 CTCACGCAAGCTCCGCCTCCTGG - Intronic
904142795 1:28367263-28367285 CACTTGCAAGCTCTGCCTCCCGG + Intergenic
904575457 1:31502416-31502438 CTCACCCAAGTTCTTACTGCTGG - Intergenic
904830390 1:33302717-33302739 CTCTTCCAAGCTCTGCATTCAGG + Intergenic
904850360 1:33454745-33454767 TTCTCCCCTGTTCTGCTTCCTGG + Intergenic
904883767 1:33720396-33720418 CTCTCCCCAGCTCTGCATCTAGG - Intronic
905655778 1:39685033-39685055 GTCTCCCAATTTCTTCCTCAAGG + Intronic
906024098 1:42658416-42658438 CGCTCCCGACTTCTGCTTCCGGG + Exonic
906144451 1:43551552-43551574 CAGTCCCAAGGTCTCCCTCCAGG + Intronic
906396116 1:45466398-45466420 CTCACTCAACCTCTGCCTCCTGG - Intronic
906976527 1:50579755-50579777 CTCTCCCCATTTTTTCCTCCTGG - Intronic
907208151 1:52793415-52793437 CTCCCTCAACCTCTGCCTCCAGG - Intronic
909099153 1:71329813-71329835 CACTCTCAAGCTCCGCCTCCTGG + Intergenic
909626571 1:77723737-77723759 CACTGCCAAGTTCTGCCTCCCGG + Intronic
910628485 1:89333722-89333744 CTCATTCAAGCTCTGCCTCCTGG - Intergenic
910683327 1:89890110-89890132 CACTGCCAAGCTCCGCCTCCCGG - Intronic
911059950 1:93739100-93739122 ATCTCCCAGGTTCTGCTCCCTGG + Intronic
911719441 1:101174388-101174410 CTCACTCAACCTCTGCCTCCCGG - Intergenic
912682388 1:111737781-111737803 CTCTCTCTAGTCCTCCCTCCTGG - Intronic
912717215 1:111990804-111990826 CGCTCCCAAGTCCAGACTCCCGG - Intergenic
913215158 1:116613943-116613965 CTCCCCCAGGCTCTGCCTCTGGG + Exonic
914796419 1:150924014-150924036 CTCACGCAAGCTCCGCCTCCCGG - Intergenic
916045109 1:160994160-160994182 CTCACGCAACCTCTGCCTCCCGG + Intergenic
917285163 1:173415567-173415589 CTCTGCCAAGTGCTGCCCCTTGG - Intergenic
919889431 1:201959923-201959945 CACTGCCAAGTTCCGCCTCCCGG - Intronic
920319201 1:205104762-205104784 CTCACACAACCTCTGCCTCCTGG - Intronic
920949996 1:210563560-210563582 CTCTCCCATGATCAGCCTCCAGG - Intronic
921015886 1:211190527-211190549 CTCACGCAAGCTCTGCCTCCCGG - Intergenic
922241046 1:223755720-223755742 CCATCCCCAGTTCTGCCTCTGGG - Intronic
923390533 1:233510576-233510598 TTCTCCCAACATCTGCCTCCAGG - Intergenic
924311741 1:242750845-242750867 CTCACACAACTTCCGCCTCCCGG - Intergenic
924463881 1:244283415-244283437 CTCTCACCATTTCTGCCACCCGG + Intergenic
924734619 1:246744687-246744709 CTCACTCAATCTCTGCCTCCCGG + Intronic
924752347 1:246905946-246905968 CACTCCCCAGTTCTACCTCTTGG - Intronic
1063424804 10:5942569-5942591 CCCTCCACCGTTCTGCCTCCTGG + Intronic
1064520760 10:16198373-16198395 CCCTCACAACCTCTGCCTCCTGG - Intergenic
1064623743 10:17241321-17241343 CTCATGCAACTTCTGCCTCCGGG - Intergenic
1064710572 10:18119853-18119875 TTCTAACAAGTTCTGCCTGCTGG - Intergenic
1064962068 10:20976264-20976286 CACTGCCAACTTCTGCCTCCTGG - Intronic
1066605211 10:37159767-37159789 CTCACGCAAGCTCTGCCTCCCGG + Intronic
1066605930 10:37170872-37170894 CTCACGCAAGCTCTGCCTCCCGG + Intronic
1066606713 10:37182664-37182686 CTCACGCAAGCTCTGCCTCCCGG + Intronic
1066607483 10:37194413-37194435 CTCATGCAAGCTCTGCCTCCCGG + Intronic
1067112506 10:43409924-43409946 CTCACGCAAGCTCCGCCTCCCGG - Intergenic
1067291954 10:44950157-44950179 CTGTGCCAAGCTCTCCCTCCAGG + Intergenic
1067293151 10:44959129-44959151 CTCTCCCAGTCACTGCCTCCTGG - Intergenic
1067367098 10:45642530-45642552 CACTTGCAAGCTCTGCCTCCCGG - Intronic
1067684488 10:48458403-48458425 CTCTCCCAAGGTGTGGTTCCTGG - Intronic
1069710429 10:70484611-70484633 CTCACTCAAGCTCCGCCTCCCGG + Intronic
1070713501 10:78700713-78700735 CTCTCCCAAGTTGAGCCTCCAGG + Intergenic
1071398033 10:85242350-85242372 CTATCCTTAGTTCTGCCCCCTGG + Intergenic
1071506283 10:86233757-86233779 CTGTCCCAGGCTCTGCCTCTAGG + Intronic
1071615820 10:87075172-87075194 CTCAGCCAACCTCTGCCTCCTGG + Intronic
1072585850 10:96781515-96781537 CTCACCCAAGCTCTGCCTCCCGG + Intergenic
1072665326 10:97388507-97388529 CACTGCCAAGTTCTGCATCCAGG - Exonic
1072927623 10:99630201-99630223 CTCACTCAAACTCTGCCTCCTGG + Intergenic
1073054222 10:100688775-100688797 CTCACTCCATTTCTGCCTCCTGG - Intergenic
1073056495 10:100706689-100706711 CTCCCCGAAGTCCTGCATCCTGG + Intergenic
1073362253 10:102909346-102909368 CACTGCAAACTTCTGCCTCCTGG + Intergenic
1073489601 10:103844280-103844302 CTGTCCTGAATTCTGCCTCCTGG - Intronic
1073983875 10:109186065-109186087 CACTTGCAAGCTCTGCCTCCTGG - Intergenic
1074084355 10:110196446-110196468 CTACCCAAAGTTCTGCCTTCAGG - Intergenic
1074969081 10:118521016-118521038 CTCTCCCCATTCCTGGCTCCAGG + Intergenic
1075899719 10:126031074-126031096 CTCTCCACAGTCCTCCCTCCAGG - Intronic
1077025809 11:439389-439411 CTCTTCCCAGTCCAGCCTCCAGG + Intronic
1077277470 11:1720948-1720970 CTCTCCCAAGATGGGCCCCCAGG - Intergenic
1077581126 11:3417986-3418008 CTCTCCCTCACTCTGCCTCCTGG - Intergenic
1078019220 11:7641356-7641378 ATCTGCCCAGTTCTGCCTTCAGG - Intronic
1078375111 11:10786790-10786812 CTCACTCAACCTCTGCCTCCTGG + Intergenic
1080529793 11:33163613-33163635 AGCTCCCAAGCTCCGCCTCCTGG + Intergenic
1081149875 11:39615015-39615037 CTCTCGCAAGCTCTGCCTCCCGG + Intergenic
1082790945 11:57346474-57346496 CTCTCCCAGCTTCTGTCTGCTGG + Intronic
1083216062 11:61220916-61220938 CTCTCATAACCTCTGCCTCCTGG + Intergenic
1083218946 11:61239742-61239764 CTCTTACAACCTCTGCCTCCTGG + Intergenic
1083741585 11:64714114-64714136 CTCTCCTAAGTGCTGGCCCCCGG - Intronic
1084238054 11:67800824-67800846 CTCTCCCTCACTCTGCCTCCTGG - Intergenic
1084239384 11:67808231-67808253 CTCCTGCAACTTCTGCCTCCCGG + Intergenic
1084312213 11:68323811-68323833 CCCTCCCAGGTTATGCCCCCGGG + Intronic
1084407233 11:68981150-68981172 CTCAGCCCAGATCTGCCTCCAGG + Intergenic
1084834356 11:71792010-71792032 CTCTCCCTCACTCTGCCTCCTGG + Intronic
1085090765 11:73711190-73711212 CTCTACCATGCTCTGCCTCTAGG + Intronic
1086187409 11:84035171-84035193 CTCTCCCTACCTCTGCCTTCTGG + Intronic
1086883804 11:92180357-92180379 CTCTACCAGGCTCTGCTTCCAGG - Intergenic
1088092440 11:106058496-106058518 CTCACCCAACCTCAGCCTCCTGG + Intronic
1089329299 11:117678669-117678691 CTATCCCCCGTTCTGCTTCCTGG - Intronic
1089331611 11:117692847-117692869 AGCTCCCAAGTTCTGCCCTCTGG + Intronic
1089423623 11:118351111-118351133 CTCACGCAAGCTCCGCCTCCCGG - Intronic
1089860519 11:121586476-121586498 CTCTGCCACGATCAGCCTCCAGG - Intronic
1090236248 11:125149831-125149853 CGCTCCCAAGTCCTGCCCCAAGG + Intergenic
1090349079 11:126095740-126095762 CTCACCCCAGATCTGTCTCCAGG - Intergenic
1090402136 11:126455719-126455741 CACTGGCAAGCTCTGCCTCCTGG - Intronic
1090472147 11:126990094-126990116 CTCTCCCTAGAGCCGCCTCCAGG - Intronic
1090651214 11:128807815-128807837 CTGACCCAAAGTCTGCCTCCTGG + Intronic
1091044430 11:132313022-132313044 CTCACCCAACATCTGCCTCCAGG - Intronic
1091470195 12:719812-719834 CACTCTTAAGTTCCGCCTCCCGG + Intergenic
1091540963 12:1461591-1461613 CTCACGCAACCTCTGCCTCCTGG - Intronic
1091552721 12:1548948-1548970 CTCACGCAAGCTCCGCCTCCTGG - Intronic
1091560065 12:1605485-1605507 CTCCCCGAAGTTCTGCTCCCGGG - Intronic
1092408724 12:8238454-8238476 CTCTCCCTCACTCTGCCTCCTGG - Intergenic
1092505718 12:9097705-9097727 CTCACTCAACCTCTGCCTCCTGG + Intronic
1092802895 12:12188346-12188368 CTCTGCCCATCTCTGCCTCCTGG - Intronic
1092880588 12:12885103-12885125 CACTCCCAATTACTGCCTCTAGG + Intergenic
1093363307 12:18259388-18259410 CTCTGCTAAGTTCTACCTACTGG + Intronic
1094209853 12:27877759-27877781 CTGTCTCAGGTTCTGCTTCCTGG - Intergenic
1094421542 12:30276792-30276814 CCCACCTCAGTTCTGCCTCCCGG + Intergenic
1096258137 12:50075074-50075096 CTCTCCTAAGTTCATCTTCCAGG + Intronic
1096763840 12:53866849-53866871 CTCTCCAAAGCTCTGTCTGCAGG + Intergenic
1097107752 12:56635260-56635282 CTCTCCCAAGTCCTTCCTTTCGG - Intronic
1097285729 12:57875684-57875706 CTCACGCAACCTCTGCCTCCTGG - Intergenic
1097584214 12:61495600-61495622 CTCACTCAAGCTCCGCCTCCCGG + Intergenic
1098473519 12:70872619-70872641 CTCATGCAAGCTCTGCCTCCTGG - Intronic
1099470363 12:83040757-83040779 CTCACGCAAGCTCTGCCTCCCGG + Intronic
1099977490 12:89561211-89561233 CTCTCCCAACTCCTTTCTCCAGG + Intergenic
1100121482 12:91373843-91373865 CCCTCCCAAGCTCTACCTCATGG - Intergenic
1100550180 12:95639901-95639923 CTCTCCCACTTCCTGCATCCAGG + Intergenic
1100591970 12:96037765-96037787 CTCACACAAGCTCCGCCTCCCGG + Intronic
1100691376 12:97041785-97041807 CTCACACAAGCTCCGCCTCCTGG - Intergenic
1100724177 12:97391423-97391445 CTGTGCCATGTTCTGACTCCAGG - Intergenic
1101282856 12:103277692-103277714 CTCACCCAAGCTCCACCTCCCGG + Intronic
1101700835 12:107172309-107172331 CTCACGCAACCTCTGCCTCCTGG + Intergenic
1102272375 12:111548791-111548813 ATCTCGCAATCTCTGCCTCCCGG + Intronic
1102351762 12:112197908-112197930 CTCTAGCAACCTCTGCCTCCTGG + Intronic
1102367313 12:112349312-112349334 CTCACTCAACCTCTGCCTCCTGG - Intronic
1102422939 12:112818223-112818245 CTCACTGAAGCTCTGCCTCCCGG - Intronic
1102529615 12:113536714-113536736 CTCTCCCATCTGCTGCTTCCTGG - Intergenic
1103177235 12:118875153-118875175 TTCTCTCAAGCTCTGCCTTCAGG - Intergenic
1103651101 12:122433218-122433240 CTCACGCAACTTCTGCTTCCTGG - Intergenic
1104725475 12:131072909-131072931 CTCTCCCCAGTGCTGGCTCCTGG - Intronic
1104742731 12:131190204-131190226 CACTCCCAAGTGCAGCCTGCTGG + Intergenic
1104841365 12:131827613-131827635 CTCTCCCAAGATCTCCCACTCGG + Intergenic
1105218889 13:18307433-18307455 CTCCCCCAGGCTCTGCCTCCAGG + Intergenic
1105384080 13:19914005-19914027 TTGTCCCAAGTTTTGCCTACTGG - Intergenic
1105828046 13:24139991-24140013 CACTGCCAAGCTCCGCCTCCCGG - Intronic
1105974798 13:25464125-25464147 CTCTGCCAGATTCAGCCTCCTGG + Intronic
1106396955 13:29390576-29390598 CTCACTCAGCTTCTGCCTCCTGG - Intronic
1106579839 13:31008022-31008044 CTCTCTCAAGGTCTGCTCCCAGG + Intergenic
1107099686 13:36576642-36576664 CTCACGCAAGCTCCGCCTCCCGG + Intergenic
1107479905 13:40777546-40777568 CCCTCTCAAGTTATGCCTTCGGG + Intergenic
1107505227 13:41027056-41027078 CTGCCCTAAGTTCTGCCTACTGG - Intronic
1107594433 13:41947841-41947863 CCCTCCCAGGTTCAACCTCCAGG - Intronic
1107684682 13:42885301-42885323 CTCACTCAACCTCTGCCTCCTGG - Intergenic
1110175503 13:72550988-72551010 CTCTTGCAATCTCTGCCTCCCGG + Intergenic
1110339282 13:74370199-74370221 CTCTCTCAAGCTCTCTCTCCTGG + Intergenic
1112348644 13:98614256-98614278 TTGTCCCAAGCTCTGCCTCTGGG - Intergenic
1112774756 13:102831968-102831990 TTTTTGCAAGTTCTGCCTCCCGG - Intronic
1113849686 13:113410935-113410957 CTCTGAGAAGTTCAGCCTCCTGG - Intergenic
1114127954 14:19752594-19752616 GTCTCCAAAGTTCTGCCCACAGG - Intronic
1115027187 14:28759207-28759229 CTGTCCCAACTTGGGCCTCCTGG - Intergenic
1115224812 14:31091387-31091409 CTCACCTAAGTTCTGGCTTCTGG + Intronic
1115273798 14:31584197-31584219 GGCACCCAACTTCTGCCTCCCGG + Intronic
1115299837 14:31872040-31872062 CTCTCCCAGTATCTGTCTCCAGG - Intergenic
1116314240 14:43366780-43366802 CTCACTGAAGCTCTGCCTCCCGG - Intergenic
1116756224 14:48951613-48951635 CTCTCCCTAATTCTACCTTCAGG - Intergenic
1116839998 14:49810291-49810313 CTCATGCAAGCTCTGCCTCCTGG - Intronic
1117130659 14:52683131-52683153 CACTGCCAACTTCCGCCTCCTGG - Intronic
1117487566 14:56213476-56213498 CTCTCCCTCTTTCTGTCTCCAGG - Intronic
1118171272 14:63391496-63391518 CACTGCAAACTTCTGCCTCCCGG + Intronic
1118519196 14:66562173-66562195 CTCTCCTAAGTTCTGTCTCTGGG + Intronic
1119042333 14:71286247-71286269 CTGTCCCAAATTCAGCCTCTAGG - Intergenic
1119430569 14:74565649-74565671 CTCTCCCAAGTTCTGCCTCCTGG - Intronic
1119790809 14:77348295-77348317 CTCACTCAAGCTCCGCCTCCCGG + Intronic
1121110155 14:91307185-91307207 CTCTCCCTGGTTCTGCCTGAGGG + Exonic
1121770448 14:96531074-96531096 CTCACTGCAGTTCTGCCTCCTGG + Intronic
1122255375 14:100472325-100472347 CTCTCACGCGTGCTGCCTCCAGG - Intronic
1122480365 14:102043206-102043228 CACTGCCAACCTCTGCCTCCTGG - Intronic
1122640521 14:103156593-103156615 CTGGCCCCAGTTCTGCTTCCCGG - Intergenic
1122665939 14:103329580-103329602 CTCTTGCAACCTCTGCCTCCTGG - Intergenic
1122689428 14:103524742-103524764 CTCCCCCCAAGTCTGCCTCCAGG - Intergenic
1202849144 14_GL000225v1_random:5707-5729 CTCATCTAAGTTCTGCCTACAGG - Intergenic
1202851851 14_GL000225v1_random:25607-25629 CTCATCTAAGTTCTGCCTACAGG + Intergenic
1202855655 14_GL000225v1_random:50136-50158 CTCATCTAAGTTCTGCCTACAGG - Intergenic
1202860097 14_GL000225v1_random:76090-76112 CTCATCTAAGTTCTGCCTACAGG + Intergenic
1202861536 14_GL000225v1_random:85799-85821 CTTTTCCAAGATCTGCCTACAGG + Intergenic
1202863128 14_GL000225v1_random:97005-97027 CTCAACTAAGTTCTGCCTTCAGG + Intergenic
1202864614 14_GL000225v1_random:107473-107495 CTCATCTAAGTTCTGCCTACAGG - Intergenic
1202864937 14_GL000225v1_random:110470-110492 CTCATCTAAGTTCTGCCTACAGG - Intergenic
1202865969 14_GL000225v1_random:117454-117476 CTCATCTAAGTTCTGCCTACAGG + Intergenic
1202867013 14_GL000225v1_random:127394-127416 CTCTTCTAAGTTCTGCCTACAGG + Intergenic
1124042234 15:26116196-26116218 CTCTCCCAAATTCTGTCTGCAGG - Intergenic
1124544948 15:30618250-30618272 CTCACGCAAGCTCCGCCTCCCGG + Intergenic
1124579592 15:30941748-30941770 CTTTCACAAGCTCTCCCTCCTGG - Exonic
1124778470 15:32607654-32607676 CTCACGCAAGCTCCGCCTCCCGG + Intergenic
1125184955 15:36919501-36919523 CTCCCACAACTTCTGCCTCCCGG - Intronic
1125648238 15:41291547-41291569 CACTTGCAAGCTCTGCCTCCTGG + Intergenic
1125685287 15:41559885-41559907 CTCTCCAAGGTTCTGCTTTCAGG - Intronic
1125754455 15:42053404-42053426 CTCTCCCGTGGTCTGACTCCAGG + Intergenic
1126018912 15:44379767-44379789 CTCTCCCCAAATATGCCTCCAGG + Exonic
1126980376 15:54235774-54235796 CTCACGCAAGCTCCGCCTCCCGG - Intronic
1127411358 15:58710202-58710224 CTCACGCAACCTCTGCCTCCTGG - Intronic
1127430690 15:58904619-58904641 CTCTGCAAACCTCTGCCTCCCGG + Intronic
1127987960 15:64089438-64089460 CGCTCTCAACCTCTGCCTCCTGG - Intronic
1127998950 15:64172798-64172820 GTCCTCCAAGTTCTGCTTCCTGG + Intronic
1130132614 15:81156938-81156960 TTATCCCAAGTTATGTCTCCAGG + Intergenic
1131429178 15:92372761-92372783 CTCTCTGAAGTCCTGGCTCCTGG - Intergenic
1131536814 15:93244654-93244676 CTCTCCAAACCTCTCCCTCCCGG + Intergenic
1132301568 15:100779358-100779380 CGCTCCCGAGTTCTGATTCCAGG + Intergenic
1132571305 16:645566-645588 CTTTGACAAGTTCTTCCTCCTGG + Intronic
1132585193 16:703131-703153 CTCTGCCCTGTTCTGCCTCATGG + Intronic
1132593382 16:736605-736627 GCCTCCCAGGTTCAGCCTCCTGG + Intronic
1132666777 16:1084598-1084620 GACTCCCCAGTTCTCCCTCCCGG + Intergenic
1133159242 16:3898808-3898830 CTCTCGCAACCTCTGCCTCCCGG - Intergenic
1133333119 16:4988374-4988396 CTCTGCCAAGCCCTCCCTCCTGG + Intronic
1133349689 16:5093271-5093293 CTCTCCCTCACTCTGCCTCCTGG - Intronic
1133489356 16:6251912-6251934 TTCTCCTAAATTCTGTCTCCTGG + Intronic
1134040449 16:11064354-11064376 CTCACCCATGTGCTGCCGCCCGG + Intronic
1134518764 16:14908063-14908085 CTGTCTCCAGCTCTGCCTCCAGG + Intronic
1134684960 16:16152115-16152137 CACTTGCAAGCTCTGCCTCCCGG - Intronic
1134706435 16:16306716-16306738 CTGTCTCCAGCTCTGCCTCCAGG + Intergenic
1134890610 16:17838397-17838419 CTCACGCAACCTCTGCCTCCCGG - Intergenic
1134961105 16:18405394-18405416 CTGTCTCCAGCTCTGCCTCCAGG - Intergenic
1134965407 16:18487997-18488019 CTGTCTCCAGCTCTGCCTCCAGG - Intronic
1135958944 16:26979802-26979824 CTCTTCCAAGTACTGCCTATGGG + Intergenic
1136562066 16:31045315-31045337 CACTGCCAACCTCTGCCTCCTGG - Intergenic
1137395104 16:48111495-48111517 CTCACCCTAGTTTTGGCTCCAGG - Exonic
1137573032 16:49579058-49579080 CTCTCCCACCCTCTGCATCCTGG - Intronic
1137680713 16:50342493-50342515 CTGTCGCAAGCTCTGCCTCCTGG + Intronic
1137734726 16:50715488-50715510 CTCATGCAAGCTCTGCCTCCCGG + Intronic
1137866094 16:51898260-51898282 CCCTCCCAAATTCTGTCTACTGG + Intergenic
1138133861 16:54504597-54504619 CTCTCCCCAGCTCTGCTTCTCGG - Intergenic
1138736608 16:59258702-59258724 CACTTGCAAGCTCTGCCTCCCGG + Intergenic
1138747662 16:59382262-59382284 CTCTCTCATGTTCTGTTTCCAGG + Intergenic
1139095378 16:63698826-63698848 CTCACGCAACCTCTGCCTCCCGG + Intergenic
1139484163 16:67246851-67246873 CCCTCCCCAGCTCCGCCTCCAGG + Intronic
1139622678 16:68159495-68159517 CTCACGCAAGCTCCGCCTCCTGG + Intronic
1139805506 16:69562435-69562457 CTCACTCAACCTCTGCCTCCTGG + Intergenic
1140226222 16:73079448-73079470 CTGTCCCAACCTCTGCCTCCTGG - Intergenic
1140612143 16:76613130-76613152 CTCACGCAACCTCTGCCTCCTGG + Intronic
1141484509 16:84329971-84329993 CCCTCCCAAGGTCTGCTTCAGGG - Intergenic
1141532171 16:84654064-84654086 CTTTCCCCAGTCCTGCCCCCTGG + Intronic
1142147543 16:88498909-88498931 CTCTCCCAAGCACTGGCCCCAGG + Intronic
1142271555 16:89092337-89092359 CTGTCCCAAGTCCTGTCTCTAGG + Intronic
1142373082 16:89693788-89693810 CTTTCCCTGGTTCTTCCTCCTGG + Intronic
1143335003 17:6165493-6165515 ATATCCCTTGTTCTGCCTCCTGG - Intergenic
1144282903 17:13744710-13744732 TTCTCCCAAGGTCTCTCTCCTGG + Intergenic
1144518719 17:15939784-15939806 CTCACGCAAGCTCCGCCTCCTGG - Intergenic
1145193943 17:20870118-20870140 CACTGCCAAGCTCTGCCTCCTGG + Intronic
1145763532 17:27442068-27442090 ACCTCCCAACCTCTGCCTCCCGG - Intergenic
1146016312 17:29236607-29236629 CTCACGCAACCTCTGCCTCCTGG + Intergenic
1146114762 17:30125119-30125141 CTCACTCAACCTCTGCCTCCAGG - Intronic
1146189656 17:30753619-30753641 CACTGCAAAGTTCTGCCTCCTGG + Intergenic
1147305789 17:39563557-39563579 CTCTCCCAACTGCTGCCAGCCGG + Intronic
1147450548 17:40501370-40501392 CACTGCCAACGTCTGCCTCCAGG - Intronic
1148049458 17:44762247-44762269 CACTTCCCAGTTCTGCCTCCAGG + Intronic
1148591710 17:48821114-48821136 CACTGCCAACCTCTGCCTCCTGG - Intergenic
1150343799 17:64388739-64388761 CTCACCGAACCTCTGCCTCCTGG + Intronic
1150370336 17:64632031-64632053 CACTGCCAACCTCTGCCTCCCGG + Intronic
1150740084 17:67772359-67772381 CTCTGCCAAGTCCTTCCACCTGG - Intergenic
1150938016 17:69658759-69658781 CTCACTCAACCTCTGCCTCCTGG + Intergenic
1151471246 17:74319276-74319298 CCCTCCCAAGTCGTACCTCCAGG + Intergenic
1152746629 17:82043346-82043368 CTCCCCCAAGCTCAGCCTCATGG - Intergenic
1153292510 18:3515393-3515415 CTCACTCAAGCTCCGCCTCCTGG - Intronic
1153845008 18:9041664-9041686 CACTGCCAACCTCTGCCTCCCGG - Intergenic
1154506235 18:15043352-15043374 CTCTTCAAAGTTCTGCCCACTGG - Intergenic
1155863823 18:30939081-30939103 CAATTTCAAGTTCTGCCTCCCGG - Intergenic
1155981439 18:32184423-32184445 CTTTTCCAAGTTTTACCTCCAGG - Intronic
1156199079 18:34809380-34809402 CTCACGCAACCTCTGCCTCCTGG - Intronic
1156277017 18:35593391-35593413 CTCTCCCAAATACTTCCTCAGGG - Intronic
1157241875 18:46018441-46018463 CGCACCCAACTTCTGCCTCCTGG + Intronic
1157873118 18:51248303-51248325 CACTGCCAATCTCTGCCTCCCGG - Intergenic
1158283075 18:55849068-55849090 CTCACACAACCTCTGCCTCCTGG - Intergenic
1158513191 18:58109643-58109665 CTCACTCAACCTCTGCCTCCTGG + Intronic
1158805942 18:60972683-60972705 GTCTCACAAGCTCCGCCTCCCGG - Intergenic
1159221441 18:65469158-65469180 CTCTGCCAATTTCTGAGTCCAGG - Intergenic
1160101030 18:75919775-75919797 TGCTCCCATGTTCTTCCTCCGGG + Intergenic
1160110843 18:76028509-76028531 CACTCCCCAGATCTCCCTCCAGG + Intergenic
1160968821 19:1758417-1758439 CTCTCCCAAGTCCTACCCCATGG - Intronic
1161020380 19:2007750-2007772 CGCTGCAAAGCTCTGCCTCCTGG - Intronic
1161691947 19:5740689-5740711 CTCAAGCAACTTCTGCCTCCCGG - Intronic
1162196895 19:8991942-8991964 CTCTTGCAACTTCCGCCTCCCGG - Intergenic
1162282596 19:9711142-9711164 CTCCTGCAACTTCTGCCTCCTGG - Intergenic
1162398544 19:10431606-10431628 GGCTGCCAACTTCTGCCTCCAGG - Intronic
1162580851 19:11529317-11529339 GACTCCCAAGTCCAGCCTCCCGG - Intergenic
1163350181 19:16771868-16771890 GTCACCCAACTTCTGCCTCCTGG + Intronic
1163377766 19:16944325-16944347 CTTTCCCCAGAGCTGCCTCCAGG + Intronic
1164979274 19:32601222-32601244 CTCACGCAACCTCTGCCTCCTGG - Intronic
1165119332 19:33548994-33549016 CTGTTTCAACTTCTGCCTCCCGG - Intergenic
1165484912 19:36089771-36089793 CTCTCCCAAGCCTGGCCTCCAGG + Intronic
1165535581 19:36441819-36441841 CTCACTCAAGCTCCGCCTCCCGG + Intergenic
1165681225 19:37777947-37777969 CACTTGCAAGCTCTGCCTCCCGG - Intronic
1165682486 19:37789703-37789725 GCCTCCCGGGTTCTGCCTCCCGG - Intronic
1165939518 19:39408156-39408178 CTGTCACAAGTTCTACCTCCAGG + Exonic
1166705946 19:44908076-44908098 CTCTTCCCATTTCTGACTCCTGG + Intronic
1166849725 19:45753721-45753743 CTCTCAGAAGTCCTGTCTCCAGG + Exonic
1166860845 19:45810243-45810265 CACTGCCAAGCTCCGCCTCCTGG + Intronic
1167014967 19:46835181-46835203 TTCTTGCAAGTTCTGCCTCAGGG + Intergenic
1167030759 19:46958307-46958329 CACTGCCAAGCTCCGCCTCCTGG - Intronic
1167405012 19:49300975-49300997 CTCACGCAACTTCCGCCTCCCGG - Intronic
1168064895 19:53913629-53913651 CTCTCCCTAGCTCTGACTGCTGG + Intronic
1168275111 19:55273636-55273658 CTCCCCCAAATACTGCCGCCTGG - Intronic
925361809 2:3285198-3285220 CTGTCCCAGGTTCTTCCTCTTGG - Intronic
925460788 2:4060910-4060932 CTGCTCCAAGTTCTGCCTACTGG - Intergenic
925918341 2:8623134-8623156 CTCTCTGCAGTTCTGCCTCCCGG + Intergenic
926035723 2:9633958-9633980 TCCTCCCATGTTCAGCCTCCCGG - Intergenic
926201058 2:10798109-10798131 CTCTTGCAACCTCTGCCTCCTGG - Intronic
926293173 2:11547017-11547039 CTCACGCAATCTCTGCCTCCTGG + Intronic
926314845 2:11701971-11701993 CTCTGCTGAGTTCTGCCTTCTGG + Intronic
927050314 2:19321544-19321566 CTCACTCAAGCTCTGCCTCCCGG - Intergenic
927672309 2:25079029-25079051 CTCACTCATGCTCTGCCTCCTGG - Intronic
927781047 2:25939658-25939680 CTCACCCAGGCTCTGCCTCTGGG - Intronic
927869485 2:26614534-26614556 CTCTGCCAGACTCTGCCTCCTGG - Intronic
928451398 2:31381588-31381610 CTCCCCCAAGTCCTTCTTCCTGG + Intronic
931563877 2:63593172-63593194 CTCACTCAACCTCTGCCTCCCGG + Intronic
931860136 2:66346122-66346144 CTGTTTCAAGTTCTGCCTCTAGG + Intergenic
932117466 2:69066368-69066390 CTCACTCAACCTCTGCCTCCTGG + Intronic
932262108 2:70335752-70335774 CTCATGCAAGCTCTGCCTCCTGG + Intergenic
932694959 2:73948170-73948192 CTCTCCCAAGCCATGCCTCTCGG + Intronic
933740459 2:85529843-85529865 CACTGCAAAATTCTGCCTCCCGG - Intergenic
934069075 2:88366978-88367000 CTCACGCAAGCTCCGCCTCCCGG - Intergenic
934295427 2:91739202-91739224 CTCCCCCAGGCTCTGCCTCTGGG - Intergenic
935329117 2:101963341-101963363 ATCTCCCCAGTCCTGGCTCCCGG + Intergenic
935352686 2:102167383-102167405 CTCTCTCAAGTTCTACTTGCTGG - Intronic
936512557 2:113159871-113159893 CTCCTGCAACTTCTGCCTCCTGG - Intronic
937240255 2:120456200-120456222 CTCACTCAACCTCTGCCTCCCGG + Intergenic
937953115 2:127403532-127403554 CCCTCCCAACTGCAGCCTCCAGG + Intergenic
938200116 2:129366033-129366055 GTCTCCTAAGTGCTGCCTACTGG - Intergenic
938379822 2:130830244-130830266 GTCTCAAAAGTTCTGCTTCCTGG + Intergenic
938392367 2:130916070-130916092 CTCTCCCAAGCTCTGCGGCCTGG - Intronic
938809746 2:134842401-134842423 CTCTCCTTAGTTCTGACCCCAGG + Intronic
939302373 2:140361235-140361257 CTCTCCCAATATCTGCATCTGGG + Intronic
939434411 2:142155316-142155338 CACTTGCAAGCTCTGCCTCCCGG - Intergenic
941680773 2:168396448-168396470 CTCTCTCAACTTGTACCTCCTGG - Intergenic
944288565 2:197978400-197978422 CACTTGCAAGCTCTGCCTCCCGG - Intronic
944842626 2:203638959-203638981 CTCACTCAACCTCTGCCTCCTGG + Intergenic
945693748 2:213076826-213076848 CTCACGCAAGCTCCGCCTCCTGG - Intronic
947797519 2:232904301-232904323 CTTTCTCTAGCTCTGCCTCCTGG + Intronic
948036007 2:234858626-234858648 CTCTTCCAACTTTTTCCTCCGGG - Intergenic
948845708 2:240681946-240681968 CTCCCAGAAGTTCTGCCTCTGGG - Intronic
948848147 2:240692784-240692806 CTCCCAGAAGTTCTGCCTCTGGG + Intronic
948893405 2:240917556-240917578 CTCCCCCACCTTGTGCCTCCTGG - Intergenic
948957577 2:241305833-241305855 CACTGCAAAGTTCCGCCTCCCGG + Intronic
1169093724 20:2877332-2877354 CTCACGCAACTTTTGCCTCCTGG + Intronic
1169394051 20:5214298-5214320 CCCTCCCAAGCTCTGCCCCCAGG - Intergenic
1169763276 20:9120551-9120573 CTCTCCCATGTTCATCCTCTTGG + Intronic
1169842225 20:9951973-9951995 CACCGCCAACTTCTGCCTCCCGG - Intergenic
1170188458 20:13618941-13618963 CACTGCCAACCTCTGCCTCCTGG + Intronic
1170554577 20:17505147-17505169 CTGTCCGAAGTGCTTCCTCCGGG + Intronic
1171396210 20:24835420-24835442 CTGTCCCAACTGCTGGCTCCAGG + Intergenic
1172007311 20:31826418-31826440 CACTCCCAAGTCATGCCTGCTGG - Intronic
1173235379 20:41240244-41240266 CTGTCCCATGCTCTGCCTTCTGG - Intronic
1173301630 20:41808823-41808845 CGCCTCCAAGCTCTGCCTCCTGG + Intergenic
1173489321 20:43466992-43467014 CTCACGCAACTTCTGCCTCCTGG + Intergenic
1173809767 20:45948731-45948753 CTCTCCCAAAGCCTGCCTGCAGG + Exonic
1175403276 20:58712457-58712479 CTCTGCCCACTTCTCCCTCCAGG + Exonic
1175575170 20:60055646-60055668 GTCTCCCACCTTCTGCATCCAGG + Intergenic
1176203085 20:63872776-63872798 CACCCGCAAGCTCTGCCTCCTGG + Intronic
1176791619 21:13325671-13325693 CTCTTCAAAGTTCTGCCCACTGG + Intergenic
1177077559 21:16596305-16596327 CTCCCCCAAGTTCTCTCTGCTGG + Intergenic
1177676765 21:24310278-24310300 CACTTGCAAGCTCTGCCTCCCGG + Intergenic
1177990159 21:28027645-28027667 CTCTTCAAAGTTCTGCCCACTGG - Intergenic
1178248912 21:30983049-30983071 CACTGCCAAGCTCCGCCTCCCGG + Intergenic
1179032132 21:37729973-37729995 CTCACTCCAGCTCTGCCTCCTGG - Intronic
1179925398 21:44531427-44531449 CTCTCCCAGTATCTGTCTCCTGG + Intronic
1180234782 21:46451508-46451530 CCCTCCCAAGTTTTGCCAGCTGG - Intergenic
1180688249 22:17687589-17687611 CTACTGCAAGTTCTGCCTCCTGG + Intronic
1181013404 22:20055050-20055072 CTCCCCGAAGTGCTGCCCCCAGG - Intronic
1181031554 22:20150677-20150699 CCCACCCAAGCCCTGCCTCCAGG + Exonic
1181554077 22:23657604-23657626 CTCACGCAAACTCTGCCTCCCGG + Intergenic
1181809322 22:25393709-25393731 CTCTCCCAGGTTGTGCCCCTGGG - Intronic
1181834756 22:25594801-25594823 CACTTGCAAGCTCTGCCTCCTGG - Intronic
1182360215 22:29742066-29742088 CTCTCTGAAGTTCTGCCTGCTGG + Intronic
1182365486 22:29775975-29775997 CTGTCCCAGCTTTTGCCTCCAGG - Intergenic
1182723794 22:32426422-32426444 CTCTGCAAAGTCTTGCCTCCTGG + Intronic
1183604831 22:38862250-38862272 ATCTCCCTATTTCTGCATCCTGG + Exonic
1184076020 22:42178655-42178677 ATCTCGCAACCTCTGCCTCCCGG + Intronic
1184134202 22:42536783-42536805 CTCACTCCAGTTCTGCCTCCTGG - Intergenic
1184749133 22:46474181-46474203 CTCTCCCCAGCCCTGCCCCCGGG - Intronic
1184777880 22:46632329-46632351 GTCTCCCATCTCCTGCCTCCTGG - Intronic
1184848326 22:47102678-47102700 CTCTCCTAAGTTCTGCTCCCTGG + Intronic
1184940133 22:47758444-47758466 CTGTCCCACTTTATGCCTCCTGG - Intergenic
1185029503 22:48434288-48434310 CCCTCTCCAGTTCTGCTTCCTGG - Intergenic
1185145395 22:49132256-49132278 CTTTCCAACGTTCTGTCTCCTGG + Intergenic
1185160004 22:49218655-49218677 CTCTAGCAAGCTGTGCCTCCCGG - Intergenic
1185261687 22:49869047-49869069 CTCACCCAACCTCCGCCTCCTGG - Intronic
949702846 3:6779353-6779375 CACTCACATGTTCTGCCTCGGGG - Intronic
950112996 3:10432474-10432496 CCCTCTCATGTTCTGGCTCCTGG - Intronic
950633766 3:14300988-14301010 CTCTCCCAGGCTCAGGCTCCTGG - Intergenic
950756660 3:15178859-15178881 CTGTCCCAAACTCTGCTTCCAGG + Intergenic
950759974 3:15213953-15213975 CACTGCCAAGTTCCGCCTCCGGG + Intronic
951313272 3:21156977-21156999 TTGTCCCAAGATCTTCCTCCTGG - Intergenic
951623228 3:24629589-24629611 CTCACCCAAACTCTGCCCCCTGG - Intergenic
951682790 3:25311863-25311885 CACACTCAAGCTCTGCCTCCTGG + Intronic
951715433 3:25639380-25639402 CTCACTCAACCTCTGCCTCCTGG + Intronic
952494028 3:33900581-33900603 CTCTCCTGAGTCCTGCCTCCTGG + Intergenic
953157798 3:40390851-40390873 CTGCCCCAACTTCTGCCCCCTGG + Intronic
953948990 3:47173525-47173547 CTCACTCAACCTCTGCCTCCTGG - Intergenic
954165607 3:48755069-48755091 CTCACGCAAGCTCTGCCTCCCGG + Intronic
954248431 3:49349842-49349864 CATTCCCAAGTCCTTCCTCCTGG - Intergenic
954701040 3:52451086-52451108 CTCTCCCAAGGTCTGCTATCTGG - Exonic
954761113 3:52874992-52875014 CTCTCGTGAGTTCTGCCTGCTGG - Intronic
954822364 3:53341378-53341400 CTCATGCAAGCTCTGCCTCCCGG - Intronic
955251809 3:57290368-57290390 ATCTCCCAAGTTGTCTCTCCTGG + Intronic
955539152 3:59955745-59955767 CTCTCCCAACATCTGCCATCAGG + Intronic
955807876 3:62756125-62756147 CTCACTCAACCTCTGCCTCCTGG + Intronic
956078128 3:65527838-65527860 ATCTCGCAACCTCTGCCTCCTGG - Intronic
956751386 3:72346563-72346585 CTCTTCCAGATTCTGGCTCCAGG - Intergenic
956863480 3:73347502-73347524 CACTCACAACCTCTGCCTCCTGG + Intergenic
957053993 3:75430619-75430641 CTCTCCCTCACTCTGCCTCCTGG - Intergenic
958614282 3:96471120-96471142 CTCACGCAAGCTCCGCCTCCTGG - Intergenic
959083186 3:101824014-101824036 CTCTGCAACCTTCTGCCTCCTGG - Exonic
959646747 3:108712105-108712127 CCCTCTCAATTTGTGCCTCCAGG - Intergenic
960857757 3:122120590-122120612 CCCTCCCCAGCTCTGCTTCCAGG - Exonic
960941937 3:122940691-122940713 CTCTTCCCAGCTCTGGCTCCAGG + Intronic
961300844 3:125921096-125921118 CTCTCCCTCACTCTGCCTCCTGG + Intergenic
961858786 3:129897426-129897448 CTCTTCAAAGTTCTGCCAACTGG + Intergenic
962190208 3:133302494-133302516 CACTTGCAAGCTCTGCCTCCCGG + Intronic
962858014 3:139367360-139367382 CACTGCCAACTTCTACCTCCCGG + Intronic
963732838 3:148989512-148989534 TTGTCCCCAGTTCTACCTCCTGG + Intergenic
964279207 3:155044592-155044614 CTCATGCAACTTCTGCCTCCCGG + Intronic
964305901 3:155339348-155339370 CTCTCCCAAATCCTGCCCCAGGG - Intergenic
965719988 3:171650821-171650843 CACTGCCAAGCTCCGCCTCCCGG - Intronic
967133584 3:186494565-186494587 ACCTCTCAACTTCTGCCTCCCGG - Intergenic
967157878 3:186710130-186710152 CTCACTGAAGTTCTGCCTCCCGG - Intergenic
967204137 3:187103982-187104004 CTCACTCAAGCTCTGCCTCCTGG + Intergenic
968154074 3:196363852-196363874 CTCTGGCAACTTCTGCCTCCCGG - Intronic
968544322 4:1189912-1189934 CACTTACAAGCTCTGCCTCCTGG - Intronic
968875081 4:3262422-3262444 CTCTCGCATGTTCTGAGTCCTGG - Intronic
968931927 4:3585252-3585274 CACTGCCAAGCTCTGCCTCCTGG + Intronic
968996796 4:3950926-3950948 CTCTCCCTCACTCTGCCTCCTGG - Intergenic
969096035 4:4733698-4733720 CTGTCCCAGGTTCTGCTTCTGGG - Intergenic
969372088 4:6739062-6739084 CTCACTCAACCTCTGCCTCCTGG + Intergenic
969518280 4:7660862-7660884 CTCCCCCTGGTGCTGCCTCCAGG - Intronic
969817163 4:9695315-9695337 CTCTCCCTCACTCTGCCTCCTGG + Intergenic
969850184 4:9949969-9949991 CCCTCCCAACAACTGCCTCCTGG + Intronic
972764720 4:42141976-42141998 CTCACCGAACCTCTGCCTCCTGG + Intronic
974067318 4:57090771-57090793 CACTGCCAACCTCTGCCTCCCGG - Intronic
975917059 4:79337695-79337717 CTCACTCAAGCTCCGCCTCCCGG - Intergenic
976606098 4:86984399-86984421 CTCACGCAACTTCTGTCTCCTGG + Intronic
977035356 4:91944148-91944170 CACTGCCAACTTCTGCCTCCTGG - Intergenic
977274214 4:94955701-94955723 CTCACTGAAGCTCTGCCTCCTGG + Intronic
978477271 4:109145140-109145162 CTCCTGCAAGCTCTGCCTCCTGG + Intronic
979179712 4:117709416-117709438 CTCTCACAACTTCTGCCTCTTGG - Intergenic
979510389 4:121547162-121547184 CTCTCCCAAGTTTTGGCATCAGG + Intergenic
981717093 4:147762602-147762624 CTCCTGCAAGCTCTGCCTCCCGG + Intronic
981757984 4:148162120-148162142 CTCTGCCCAGTTCTGGCTTCTGG - Intronic
982050720 4:151498738-151498760 CACTGCCAAGCTCTGCCTCCTGG - Intronic
982154028 4:152497246-152497268 CTCACACAAATTCTGCCTCCCGG - Intronic
983221699 4:165049974-165049996 ATCTGCCAAGTTCTGCATCCCGG - Intergenic
983347137 4:166541644-166541666 CTCTTGCAAGCACTGCCTCCTGG + Intergenic
983473273 4:168182933-168182955 CTCACGCAAGCTCCGCCTCCAGG - Intronic
984986393 4:185334261-185334283 CTCACGCAACTTCTGCCTCCCGG - Intronic
985645732 5:1083943-1083965 CCCGCCCAGGGTCTGCCTCCTGG - Exonic
985861871 5:2477760-2477782 CTCTCGCAGGTACTTCCTCCTGG + Intergenic
985875931 5:2594000-2594022 CTGTCCCAGGCTCTGCCTCTGGG - Intergenic
986152336 5:5139745-5139767 CTCTCCCACGTCCTGGCGCCCGG + Intergenic
986640048 5:9863344-9863366 CACTGCAAAGCTCTGCCTCCTGG + Intergenic
988738095 5:34042949-34042971 CTCTCTCACTTTCTCCCTCCTGG + Exonic
989097251 5:37792870-37792892 CTTTCCCAGGCTCTGTCTCCAGG + Intergenic
989262066 5:39429597-39429619 CTCACTCAAGCTCTGCCTCCCGG + Intronic
989539218 5:42599434-42599456 CTCACTCAACCTCTGCCTCCCGG + Intronic
989908960 5:49599648-49599670 CTCATCTAAGTTCTGCCTACAGG - Intergenic
990059029 5:51624118-51624140 CTCTCCAAAGTTCTGCATCAAGG + Intergenic
990256648 5:53977279-53977301 CTCACGCAAGCTCCGCCTCCCGG - Intronic
992050892 5:72939630-72939652 CACTGCCCAGCTCTGCCTCCCGG - Intergenic
992766716 5:80007584-80007606 CTCACTCAAGTTCTACCTCAAGG + Intronic
992780226 5:80120738-80120760 CTCACGCAACCTCTGCCTCCTGG - Intronic
993511276 5:88774158-88774180 CTCTAACAACTTCTACCTCCAGG - Intronic
994702798 5:103158261-103158283 CTCTTCCAAGTTCTTCAGCCTGG - Exonic
994740502 5:103611970-103611992 CTCGCTCAAGCTCTGCCTCCCGG + Intergenic
994831511 5:104788668-104788690 CTCACACAACCTCTGCCTCCTGG + Intergenic
995082959 5:108075548-108075570 CTCACTCAACCTCTGCCTCCCGG + Intronic
995245513 5:109931012-109931034 CACTCCCAAGTCCTGACTCCAGG + Intergenic
997198227 5:131993823-131993845 CTCTCCCAGGAACTGCCTCTGGG - Intronic
997569706 5:134916996-134917018 CTCTCCCACCTTCTGTCTACAGG - Intronic
998158193 5:139797862-139797884 CTCTCCTAAATTGTGTCTCCAGG - Intronic
998180448 5:139935090-139935112 CACTGCCAACTTCTGCCTCCTGG - Intronic
998604498 5:143619596-143619618 CTCACACAACCTCTGCCTCCCGG + Intergenic
998740315 5:145193379-145193401 CTCCCTCAAGTTCTGCTTCTAGG - Intergenic
998968193 5:147563331-147563353 CTCTGCCAAGTTCTTTCTGCTGG + Intergenic
999028550 5:148263549-148263571 CACTGCCAACCTCTGCCTCCTGG + Intergenic
999188047 5:149727513-149727535 CACTCCCAAGTTTGGCCTCTGGG + Intergenic
1000373252 5:160556972-160556994 CTCTCCACATCTCTGCCTCCTGG + Intergenic
1001187335 5:169587058-169587080 TTCTCTCATCTTCTGCCTCCTGG + Intronic
1001382410 5:171313221-171313243 CTCTCCCCAGTTCTGACTCTTGG + Intergenic
1001576631 5:172768959-172768981 CTCTCCCAACTTCAGCTTCATGG - Exonic
1002081020 5:176737501-176737523 TTCTCCTAAGTGCTGACTCCGGG - Intergenic
1002360266 5:178664776-178664798 CTCTCCCCAGTGCTGACTTCAGG + Intergenic
1002903218 6:1427171-1427193 CTCTCCCAAGGTCTTCTTCAGGG - Intergenic
1003668480 6:8133247-8133269 CTCCCGCAACCTCTGCCTCCTGG + Intergenic
1003673382 6:8180564-8180586 CACCCCCAAGTTCTCTCTCCAGG - Intergenic
1004457237 6:15802377-15802399 CTCACGCAACCTCTGCCTCCCGG - Intergenic
1004587507 6:17016318-17016340 CTCTCACAAGCTCCGCCTCCCGG + Intergenic
1005083418 6:21980364-21980386 CTCCCTCAAATTTTGCCTCCAGG + Intergenic
1005199497 6:23326836-23326858 CTCATGCAAGCTCTGCCTCCTGG - Intergenic
1006883980 6:37364842-37364864 CTCCCCAAACCTCTGCCTCCCGG + Intronic
1007301748 6:40872935-40872957 CACTCCCAAGAACTGCCTTCGGG + Intergenic
1007352332 6:41283040-41283062 ATATCCCATGTTCTGTCTCCAGG - Intronic
1007555760 6:42764732-42764754 CACTTGCAAGCTCTGCCTCCCGG + Intronic
1007559721 6:42796968-42796990 CTCACGCAACCTCTGCCTCCCGG - Intronic
1007594867 6:43045259-43045281 CTCTGCCATGTCCTGGCTCCAGG + Exonic
1007725455 6:43913262-43913284 CTCTCCCCAGTACCTCCTCCAGG + Intergenic
1008335689 6:50302085-50302107 ACCGCCTAAGTTCTGCCTCCTGG + Intergenic
1008914373 6:56770923-56770945 CTCACGCAACCTCTGCCTCCCGG - Intronic
1010016173 6:71106995-71107017 CTTTCACAAGTTCTTTCTCCAGG - Intergenic
1010215290 6:73395536-73395558 CACTGCCAACTTCTGCCGCCGGG - Intronic
1010247185 6:73672453-73672475 CTCACGCAACTTCTGCCTCTAGG - Intergenic
1010354444 6:74915053-74915075 CTTTCCCATGTTGTGCCTCATGG + Intergenic
1010488664 6:76448730-76448752 CTGGCCCAGGTTCTGCCTACTGG + Intergenic
1011095605 6:83658532-83658554 CGCTCACAAGCTCTGCCTCCTGG - Intronic
1012373640 6:98535323-98535345 CTCTTCCCTGTTCTGCCTCCTGG - Intergenic
1012619943 6:101331144-101331166 CTCGCGCAAGCTCTGCCTCCCGG + Intergenic
1014469006 6:121791948-121791970 CTCTCCCAGGCTTTGCCTCTAGG - Intergenic
1014940350 6:127430737-127430759 CACTGCCAAGTTCCGCCCCCCGG - Intergenic
1015646660 6:135398881-135398903 CTCTTCCAAATTCTACCTTCAGG + Intronic
1016667324 6:146657249-146657271 CTCACTCAACCTCTGCCTCCCGG - Intronic
1017041695 6:150313381-150313403 CTCCCCTAAATTCTTCCTCCAGG + Intergenic
1017126149 6:151066360-151066382 CACTTGCAAGCTCTGCCTCCTGG - Intronic
1017730113 6:157307910-157307932 CTCTACCAGCTTCTGCCCCCAGG - Intronic
1017735689 6:157360989-157361011 CTCACTGAAGCTCTGCCTCCCGG + Intergenic
1019079509 6:169420686-169420708 CGCTGCCATGTTCAGCCTCCAGG - Intergenic
1019524922 7:1476554-1476576 CCCTCCCAAGACCTGCCTGCGGG + Exonic
1019646261 7:2130650-2130672 CGCTCCCAGCTTCGGCCTCCGGG - Intronic
1020140946 7:5611355-5611377 CACTTGCAAGCTCTGCCTCCCGG + Intergenic
1020236829 7:6362346-6362368 CTCATGCAAGCTCTGCCTCCTGG - Intergenic
1020321082 7:6939310-6939332 CTCTCCCTCACTCTGCCTCCTGG - Intergenic
1020795908 7:12678260-12678282 CTCACGCAAGTGCTGCCTCCCGG - Intergenic
1021260271 7:18447913-18447935 CTCACTGCAGTTCTGCCTCCTGG + Intronic
1021754923 7:23842779-23842801 CTCTTGCAAGTGCTACCTCCCGG - Intergenic
1021896364 7:25239759-25239781 CTCACTCAACCTCTGCCTCCCGG + Intergenic
1021923252 7:25508357-25508379 CTCATGCAAGCTCTGCCTCCCGG - Intergenic
1021992125 7:26149316-26149338 CTCTCCCACTTTCTCCCTCTTGG - Intergenic
1022466742 7:30657169-30657191 CCCTCCCAAGTTCTGAATCCTGG + Intronic
1022510556 7:30932649-30932671 CCCTCCCACGCTCTCCCTCCAGG + Intergenic
1022789160 7:33669677-33669699 CTCTCCTGATTTCTGCCTCCAGG - Intergenic
1022994299 7:35738555-35738577 CTCATGCAAGGTCTGCCTCCTGG - Intergenic
1023253593 7:38290953-38290975 CTCACGCAAGCTCCGCCTCCCGG - Intergenic
1023952934 7:44861901-44861923 CTCACTCAATGTCTGCCTCCTGG + Intergenic
1024655952 7:51451554-51451576 CTCTCCCAGGTGCTGGCTCTTGG + Intergenic
1024753194 7:52494808-52494830 CACTGCTAACTTCTGCCTCCCGG + Intergenic
1024848232 7:53676630-53676652 CTCACTCAACTTCTGCCCCCAGG + Intergenic
1024858985 7:53815602-53815624 CTCTTGCACCTTCTGCCTCCTGG + Intergenic
1024931983 7:54673635-54673657 CTCCCCCAAGCACTGCTTCCTGG + Intergenic
1025613260 7:63096484-63096506 CCCTCCCAAGGTGTGCTTCCGGG - Intergenic
1025912775 7:65841171-65841193 CTTTCCCAGCTCCTGCCTCCTGG + Intergenic
1025936222 7:66039829-66039851 CTCTCTCTATTTCTTCCTCCTGG + Intergenic
1026883900 7:73925511-73925533 CACTGCAAAGCTCTGCCTCCTGG + Intergenic
1026907823 7:74072910-74072932 CTCACTCAACCTCTGCCTCCCGG + Intergenic
1026922802 7:74168919-74168941 CTCACTCAACCTCTGCCTCCTGG + Intergenic
1027340773 7:77205682-77205704 CTCACGCAACCTCTGCCTCCTGG - Intronic
1027747243 7:82092445-82092467 CACTGCCAAGCTCCGCCTCCCGG + Intronic
1029206550 7:98872398-98872420 CTCACTCAAGCTCTGCCTCCTGG - Intergenic
1030924676 7:115437513-115437535 CGCTCGCAAGCTCCGCCTCCCGG + Intergenic
1031733369 7:125326051-125326073 TTCACACAAGTTCCGCCTCCCGG + Intergenic
1031969794 7:128055784-128055806 CTCTCCCTGGGTCTGCTTCCTGG + Intronic
1032529809 7:132610765-132610787 TCCTCCCAGTTTCTGCCTCCTGG + Intronic
1032581098 7:133104165-133104187 CTCCCTCAATCTCTGCCTCCTGG - Intergenic
1033021487 7:137729581-137729603 CACTTCCAAGTTGTGCTTCCGGG + Intronic
1033331408 7:140420050-140420072 CTGTCCCAACATCTGCTTCCTGG - Intronic
1033549880 7:142437590-142437612 CTCTCCCCACTCCTGCCTCCAGG - Intergenic
1034045632 7:147924211-147924233 CTCACCCAACCTCTGCCTCCTGG + Intronic
1035080243 7:156209680-156209702 CTCTCCCGATTTGTGCTTCCAGG + Intergenic
1035298525 7:157881412-157881434 CTCTCCCAAGGCCTCTCTCCTGG - Intronic
1035656024 8:1305730-1305752 CTCTCCCAGCTTCTGCTCCCAGG - Intergenic
1036173876 8:6517652-6517674 CTGTCCCAAGTTCTACCCCAGGG + Intronic
1038596409 8:28890367-28890389 CTCTCCCACCTGCTGCCGCCGGG - Intergenic
1039231876 8:35457599-35457621 TTCTCCATATTTCTGCCTCCAGG - Intronic
1040051085 8:43015070-43015092 CAATCCCAACTTCCGCCTCCCGG - Intronic
1041869521 8:62617040-62617062 CTCTCCCTTGTTCTTGCTCCTGG + Intronic
1042213426 8:66404515-66404537 CTCTCTGGACTTCTGCCTCCAGG + Intergenic
1042352710 8:67794024-67794046 CTTTGCCAAGTTTTGTCTCCTGG + Intergenic
1042781145 8:72492201-72492223 CTCTCCCAGCTTCTGAGTCCAGG - Intergenic
1043994013 8:86790584-86790606 CGCTCACAAGCTCTGCCTCCCGG + Intergenic
1044689217 8:94860503-94860525 CTCACGCAAACTCTGCCTCCCGG - Intronic
1044754266 8:95445352-95445374 CTCACTCAATTTCTGCCTCCTGG + Intergenic
1045630829 8:104119283-104119305 CACTGCCAACTTCTGCCACCCGG - Intronic
1046003480 8:108449345-108449367 CTCACGCAATCTCTGCCTCCTGG + Intronic
1047989261 8:130268410-130268432 CACTACAAACTTCTGCCTCCTGG - Intronic
1049322003 8:142001591-142001613 TTCTCCCTTGTGCTGCCTCCTGG + Intergenic
1049372269 8:142273550-142273572 CTCTCCCAGGTCTTGTCTCCCGG + Intronic
1049609654 8:143548647-143548669 CTCACTCAACCTCTGCCTCCGGG + Intergenic
1049634755 8:143681637-143681659 CTTTCGCCAGTTTTGCCTCCTGG - Intergenic
1049723561 8:144133645-144133667 CTCACCCAAGCTCCGCCTCCTGG - Intergenic
1049797202 8:144502315-144502337 CCCTCCCATGCTCAGCCTCCTGG + Intergenic
1049849803 8:144824798-144824820 CTCTCCCCCTTTCTGCCTCCTGG + Intergenic
1050223644 9:3425161-3425183 CTCACTCAACCTCTGCCTCCTGG - Intronic
1050531886 9:6597859-6597881 CTCACTGAAGCTCTGCCTCCCGG - Intronic
1051740065 9:20242636-20242658 CTCTCACCAGCTCTGACTCCGGG + Intergenic
1052125544 9:24770313-24770335 CTCTTCAAAGTTCTGCCTTTTGG + Intergenic
1052360592 9:27552421-27552443 CGCTGCCAACCTCTGCCTCCCGG + Intronic
1052460166 9:28752840-28752862 CTCTCCCATTTTCTGCCTCTGGG + Intergenic
1054458206 9:65446677-65446699 CACTGCCAAGCTCCGCCTCCTGG - Intergenic
1055112900 9:72576934-72576956 GACTCCCAATTTCTACCTCCTGG + Intronic
1055954284 9:81759915-81759937 CTCTCCTGAGTTCAGCCTGCTGG - Intergenic
1056267316 9:84911314-84911336 CTCTCTCCACTTCTGCTTCCTGG + Intronic
1056336898 9:85580161-85580183 CTCACGCAACCTCTGCCTCCTGG - Intronic
1056499042 9:87189956-87189978 TTATTGCAAGTTCTGCCTCCTGG - Intergenic
1056591149 9:87967106-87967128 CTTCCCCGAGTGCTGCCTCCTGG - Exonic
1056795814 9:89658220-89658242 CCCTGCCAAGTTCAGCCTCTTGG - Intergenic
1057403398 9:94744315-94744337 CACTGCCAAGCTCCGCCTCCCGG - Intronic
1057590632 9:96370239-96370261 CTCTGCCTAATTCTGCCTCCTGG + Intronic
1058042106 9:100313767-100313789 CACTGCCAACCTCTGCCTCCTGG - Intronic
1059079222 9:111230511-111230533 ATCTCCCCAGTTCTCCCACCTGG - Intergenic
1059199722 9:112402868-112402890 CTCACTCAACCTCTGCCTCCCGG - Intronic
1060507283 9:124207646-124207668 CTCTTCCAACTTCTGGCTCCAGG + Intergenic
1060602705 9:124888772-124888794 CTCCACCAAGCTCCGCCTCCCGG + Intronic
1060677632 9:125529786-125529808 CTCTCCCCAGATCTGCCTTACGG + Intronic
1060930184 9:127484880-127484902 CTCACGCAACCTCTGCCTCCCGG + Intronic
1061119771 9:128635605-128635627 CTCTCCCCAGCTCTGCCTCAGGG + Intronic
1061571617 9:131481233-131481255 CACTGCCAAGCTCTGCCTCCCGG - Intronic
1061678529 9:132231455-132231477 CCCACCCAAGTTGTCCCTCCCGG + Intronic
1062660822 9:137631770-137631792 CTCTCCCCACCTCAGCCTCCCGG - Intronic
1203739390 Un_GL000216v2:165555-165577 CTCATCTAAGTTCTGCCTACAGG + Intergenic
1203739404 Un_GL000216v2:165757-165779 CTCATCTAAGTTCTGCCTACAGG + Intergenic
1203739712 Un_GL000216v2:168544-168566 CTCATCTAAGTTCTGCCTACAGG + Intergenic
1187450137 X:19388767-19388789 CTGTCCCGAGTTCTCCCTCTAGG + Intronic
1188453125 X:30330294-30330316 CAATGGCAAGTTCTGCCTCCTGG - Intergenic
1189191704 X:39114585-39114607 CTCTGCCAAGCTCTGCCTGTTGG + Intergenic
1190111624 X:47593341-47593363 CTCACTCAACCTCTGCCTCCTGG + Intronic
1190854611 X:54281408-54281430 CTCACACAACCTCTGCCTCCTGG - Intronic
1191755860 X:64591669-64591691 CTCTACCAAGTTCTAAATCCTGG + Intergenic
1192014774 X:67317525-67317547 CTCCCCCAAGTTCTGGCTAGGGG + Intergenic
1194852624 X:98888352-98888374 CCCTTGCAAGCTCTGCCTCCTGG + Intergenic
1195253439 X:103070487-103070509 CTCACTCAAGTTCCGCCTCCTGG - Intergenic
1195269100 X:103213451-103213473 CTGTTCCAAGTTCTGCTTCTAGG + Intergenic
1196824435 X:119730115-119730137 CTCACCAAGTTTCTGCCTCCAGG + Intergenic
1197618576 X:128721392-128721414 CTCACTCAATCTCTGCCTCCCGG + Intergenic
1197988922 X:132296259-132296281 CTTTTTCAAGTTCTGCCTACTGG + Intergenic
1198360942 X:135894145-135894167 CTCACCCAACCTCCGCCTCCCGG + Intronic
1199897280 X:152137335-152137357 CCCTCCCCACTTCTGCCTGCCGG - Intronic
1201176472 Y:11312368-11312390 CTCATCCAAGTTCTGCCTACAGG - Intergenic
1201178780 Y:11326464-11326486 CTCATCTAAGTTCTGCCTACAGG - Intergenic
1201179059 Y:11329062-11329084 CTCATCTAAGTTCTGCCTACAGG - Intergenic
1201317067 Y:12658062-12658084 CTCACACAACCTCTGCCTCCCGG + Intergenic
1201587181 Y:15573839-15573861 CTATTACAAGCTCTGCCTCCCGG - Intergenic