ID: 1119430577

View in Genome Browser
Species Human (GRCh38)
Location 14:74565682-74565704
Sequence CTGTAGACACAGTTGGGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 217}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119430569_1119430577 10 Left 1119430569 14:74565649-74565671 CCAGGAGGCAGAACTTGGGAGAG 0: 1
1: 0
2: 4
3: 75
4: 554
Right 1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG 0: 1
1: 0
2: 0
3: 26
4: 217
1119430568_1119430577 11 Left 1119430568 14:74565648-74565670 CCCAGGAGGCAGAACTTGGGAGA 0: 1
1: 0
2: 3
3: 65
4: 611
Right 1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG 0: 1
1: 0
2: 0
3: 26
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119430577 Original CRISPR CTGTAGACACAGTTGGGGCT GGG Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900615410 1:3563437-3563459 CTGGAGTCACAGCTGGGGCAGGG + Intronic
901072783 1:6530906-6530928 GTGTAGTCAAAGTTGAGGCTAGG - Intronic
902381664 1:16055664-16055686 CTGGAGACACTGCTGGGGGTGGG - Exonic
902813860 1:18904861-18904883 GAGTAGACACAGCCGGGGCTGGG + Exonic
903610211 1:24605917-24605939 ATGTGGACACAGTTGGGGTAGGG - Exonic
904396782 1:30227638-30227660 CTGTAGACCTAGGAGGGGCTTGG - Intergenic
904530684 1:31166808-31166830 CTTAAAACACAGTTAGGGCTGGG + Intergenic
905328778 1:37177283-37177305 CTGTCGCCATAGTTTGGGCTTGG + Intergenic
905885128 1:41487658-41487680 CTCAAGACACTGATGGGGCTGGG + Intergenic
905925502 1:41746700-41746722 CAGCAGACACTGTTGGAGCTTGG + Intronic
907315397 1:53567705-53567727 TTTTAGCCACAGCTGGGGCTAGG - Intronic
908515350 1:64886733-64886755 GTGTAGACAAGGTTGGGGCGGGG - Intronic
909056228 1:70824540-70824562 CTGGAGACATAGTCGGGGCCAGG - Intergenic
910196212 1:84642268-84642290 CTGTAGCTACAGTTGGGACACGG + Intergenic
914720628 1:150285851-150285873 CTGTAGTCCCAGCTGAGGCTGGG + Intronic
915312890 1:155013330-155013352 CTGGAGACAGTGCTGGGGCTTGG - Intronic
917810877 1:178657372-178657394 CTGTTGACTCAGTTTGGGCTGGG + Intergenic
920284928 1:204872480-204872502 CTGGTGAGACAGCTGGGGCTGGG + Intronic
922391794 1:225151317-225151339 CTGTGGATATAGTTGGGGGTGGG + Intronic
923982766 1:239343984-239344006 CTCTAAATGCAGTTGGGGCTGGG + Intergenic
1063200118 10:3779718-3779740 CTGAAGACACTGATGAGGCTTGG - Intronic
1068436024 10:56992095-56992117 CTTTAGAGACAGTTTGAGCTGGG - Intergenic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1071541603 10:86489922-86489944 CTTAAGACACAGTTTTGGCTTGG + Intronic
1073106940 10:101037485-101037507 CTGGAGAGAGAGTTGGGGCCTGG - Intronic
1074533908 10:114315183-114315205 CAGTAGCCAGAATTGGGGCTGGG + Intronic
1075090635 10:119442318-119442340 CTTTGGACACAGGTGGGGCTGGG - Intronic
1075482278 10:122792137-122792159 GTGTAGACACAGTTGTGGTTTGG - Intergenic
1077080759 11:723767-723789 CTTTGGAAACAGGTGGGGCTGGG - Intronic
1078175000 11:8963962-8963984 CTGTGGGCACTGTCGGGGCTGGG + Intronic
1080290842 11:30669903-30669925 CTGTAGCAAAAGGTGGGGCTAGG - Intergenic
1082922666 11:58512418-58512440 CTGTAGACAGAGCTGGGTTTGGG - Intergenic
1083291246 11:61691490-61691512 CTGCAGACACAGTTGGAGGCAGG - Intronic
1083356896 11:62073230-62073252 TTGTAGACACGCTCGGGGCTAGG - Intergenic
1084449097 11:69222292-69222314 CTTTAAAAACATTTGGGGCTGGG + Intergenic
1085837936 11:79976225-79976247 CTGCAGACACAGATGGAGATGGG + Intergenic
1089602532 11:119624362-119624384 CTCTAAACACAGCTGGGGCCAGG + Intronic
1091404773 12:202368-202390 CTGTAAACACAGTGAAGGCTGGG + Intronic
1094336134 12:29356332-29356354 CTTTAGACAAAGTTGGAGCTTGG - Intronic
1095505551 12:42893953-42893975 GTGTAGACAGACTTGGGTCTGGG + Intergenic
1095762334 12:45853744-45853766 CTGCTGACACAGTTCTGGCTTGG + Intronic
1097383957 12:58927273-58927295 CTGTAGTCACAGTTGTGCCTGGG - Intergenic
1097899186 12:64856691-64856713 CTCTAGACACACCTGGGGCCTGG - Intronic
1102476037 12:113189151-113189173 GTGTAGAGACATTTGGGGTTAGG + Intronic
1102478545 12:113204623-113204645 TTGTAGAAAAAGTTGGGGCCAGG + Intronic
1102860628 12:116333165-116333187 CTGTACACACTGTTGGCTCTTGG + Intergenic
1103338096 12:120205059-120205081 CTGTAGATAAAGTTGTGGCCGGG + Intergenic
1106074854 13:26449120-26449142 CTGTGGACCCATCTGGGGCTGGG + Intergenic
1107282817 13:38755945-38755967 ATGTAGACACAGCTGTGGCTTGG - Intronic
1107456729 13:40562437-40562459 CTTAAGACACATTAGGGGCTAGG - Intronic
1108752820 13:53465487-53465509 CTTAAAACACAGTTCGGGCTGGG - Intergenic
1112563003 13:100530120-100530142 CTGGAGACACAGTTGGAGAAGGG + Exonic
1113984555 13:114303452-114303474 CTGTATACACAGATGGAGCATGG - Intronic
1114223787 14:20720502-20720524 CGGTACACACAGTTGGGCATTGG - Intergenic
1114280747 14:21191061-21191083 CTGGAGAAAGAATTGGGGCTTGG - Intergenic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1117694097 14:58340778-58340800 CTTAAGACACAGGTGGGGCCGGG - Intronic
1118730882 14:68665496-68665518 TTATAGACACAGTTTGGGATGGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121349218 14:93160356-93160378 TTGTAGAAACAGGTGGTGCTGGG - Intergenic
1122347920 14:101071860-101071882 CTGTACAAACAGTTGGGGAGGGG + Intergenic
1124251739 15:28110804-28110826 CTGTGCAGACAGATGGGGCTGGG + Intergenic
1127115377 15:55721249-55721271 CTGTAGGCAGAGTGGAGGCTGGG - Intronic
1127383005 15:58445510-58445532 CTGAGGACAGAGCTGGGGCTAGG + Intronic
1127540337 15:59931540-59931562 CTAAAGACACAGTTAGGTCTAGG - Intergenic
1127832072 15:62759753-62759775 ATGTAGCCACTGGTGGGGCTGGG + Intronic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128291721 15:66483237-66483259 CTGGAGTCACAGTGGGGGGTAGG - Intronic
1131083246 15:89554474-89554496 CTGTAGACACTGTTTGGCCAGGG + Intergenic
1133214236 16:4281651-4281673 CTGTAGATACAGATGAAGCTTGG + Intergenic
1133644326 16:7749152-7749174 CTTTAGACACATTTGTAGCTAGG + Intergenic
1134103442 16:11469139-11469161 GTGCAGACACAGGTGGGCCTAGG + Intronic
1135135303 16:19882809-19882831 CTGTAGGCAGATTTGGGGGTGGG - Intronic
1138417381 16:56879249-56879271 CACCAGACACAGTGGGGGCTGGG + Intronic
1138484793 16:57332378-57332400 TTGTAGCCACAGTTGGAGCCTGG + Intergenic
1139808402 16:69589988-69590010 TTGTAGAGACAGTTGGGGAGGGG - Intronic
1141802302 16:86318333-86318355 CAGGAGACACAGTTGGAGATAGG - Intergenic
1142118664 16:88375031-88375053 CTGTGCACACAGCTGGGGCAGGG + Intergenic
1142274228 16:89107816-89107838 ATGCAGCCACATTTGGGGCTGGG - Intronic
1143622698 17:8089966-8089988 CTGAACACACAGTAGGGGTTCGG - Intergenic
1144033140 17:11340346-11340368 CTGTGGGGACAGCTGGGGCTGGG + Intronic
1145897834 17:28470834-28470856 CTGGAGATAGAGCTGGGGCTGGG - Intronic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146978800 17:37140613-37140635 TTGTAGCCACAGTTGGAGCCTGG + Intronic
1147243716 17:39107370-39107392 CTGCAGAGACAGCTGGGTCTTGG - Intronic
1148070852 17:44907717-44907739 TAGCAGACACAGTTGGGGATGGG - Intronic
1149557942 17:57587563-57587585 CTGCAGCCACCTTTGGGGCTGGG - Intronic
1149774026 17:59343345-59343367 CTGTAGACACTACTGGGGGTGGG + Intronic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1152244139 17:79176462-79176484 AAGGAGACCCAGTTGGGGCTGGG - Intronic
1158053069 18:53247119-53247141 CTATACACACAGTTTGGACTTGG + Intronic
1158134949 18:54197926-54197948 CTGTAGATAAAGTTGGGGACAGG - Intronic
1159628409 18:70720855-70720877 CTGTTGGCACAGCTGGAGCTTGG + Intergenic
1161564077 19:4989988-4990010 CTTTAGAAACAGTTTGGGCCAGG + Intronic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1162153293 19:8660342-8660364 CTGTAGACACAGAGGGGGAATGG + Intergenic
1163803467 19:19382279-19382301 GTGCAAACACAGTTGGGGCTGGG + Intergenic
1166053350 19:40274241-40274263 CTGGGGACACAGTGGGGGCTAGG - Intronic
1166091817 19:40514262-40514284 CTGCAGGCACAGTAGGGGCAAGG - Intronic
1167094838 19:47369635-47369657 CGGTGGGCACAGTGGGGGCTGGG + Intronic
1167658621 19:50782726-50782748 CTGAACCCACAGTTGGGGCTTGG - Intergenic
1167716887 19:51147776-51147798 CTCTAGACAGTGTTGGGGGTGGG - Intronic
1168121558 19:54254886-54254908 CTTTAGACACAGCGGGGGATGGG + Exonic
1168400605 19:56084207-56084229 CTGTATACCCGGGTGGGGCTGGG - Intergenic
1168694737 19:58397798-58397820 CTGTACACCTGGTTGGGGCTGGG + Intergenic
925098483 2:1226431-1226453 CTGTATTCCCAGTTGGTGCTGGG - Intronic
925500913 2:4503732-4503754 CTGTAGTTACAGTTGGTGCTTGG - Intergenic
927397122 2:22665352-22665374 CTCGAGAGACAGTTGGGGGTAGG - Intergenic
928272358 2:29867888-29867910 CTACAGACACAGTTGGGGATGGG + Intronic
929591552 2:43150796-43150818 TTCAAGACACAGTTGTGGCTGGG + Intergenic
932726336 2:74182893-74182915 CTGTAGTCCCAGCTGAGGCTGGG + Intergenic
934144247 2:89075834-89075856 CTGTACCCACAATTGGGCCTAGG + Intergenic
934224995 2:90124714-90124736 CTGTACCCACAATTGGGCCTAGG - Intergenic
935712914 2:105914952-105914974 TAGTAGACACTGCTGGGGCTGGG - Intergenic
937040482 2:118816774-118816796 TTGTAGACACTGTTGTGCCTGGG + Intergenic
937633834 2:124133469-124133491 CTGGTCACACAGTTGGGGCAAGG + Intronic
938954257 2:136283495-136283517 CTGTGGACAAAGCAGGGGCTGGG - Intergenic
939618511 2:144389279-144389301 ATGTAGACGGAGTTGGAGCTGGG - Exonic
940725060 2:157327697-157327719 CAGTAGAGACAGTTGTGGCCAGG + Exonic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
943090729 2:183371769-183371791 CTGTAGACAGAGTTGGTGCAGGG - Intergenic
946366297 2:219251161-219251183 CTGTAGACACCTGGGGGGCTGGG + Exonic
946369374 2:219271306-219271328 CTGTAGACACCTGGGGGGCTGGG - Intronic
949048569 2:241884364-241884386 CTGTAGATGGAGTTGGGTCTTGG + Intergenic
1168832697 20:855509-855531 CTGGACATACAGTTGGTGCTTGG - Intronic
1169901758 20:10560235-10560257 CTGTAGACAGGGATGGGGCCAGG - Intronic
1172336827 20:34123263-34123285 CTGTAGCCACAGCTGGAGCCTGG - Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174972606 20:55293306-55293328 GTGGAGAGACAGTTTGGGCTGGG + Intergenic
1175190289 20:57207362-57207384 CTGTAGTCACTGATGGAGCTAGG - Intronic
1176195688 20:63835579-63835601 CTGGAGCGGCAGTTGGGGCTTGG - Intergenic
1177003253 21:15639353-15639375 CTGTAGACAGAGTGCTGGCTGGG - Intergenic
1179154483 21:38838257-38838279 CTGCAGAGACAGTTGGAGCATGG - Intergenic
1180649939 22:17369451-17369473 CCGGAGAAACAGATGGGGCTAGG - Exonic
1180695046 22:17746533-17746555 CTGGTGACACAGTTAGTGCTGGG + Intronic
1180831483 22:18909193-18909215 CTGTAGGCACAGCTGGAGCCAGG + Intronic
1181173041 22:21020944-21020966 ATGTCGACACAGAGGGGGCTTGG + Intronic
1181849161 22:25737453-25737475 CAGAAGACACAGTTGGGTCAGGG + Intergenic
1182288127 22:29259972-29259994 CTTTAGACAGAGTAGGAGCTCGG + Exonic
1183597587 22:38821964-38821986 CTGGAGACTGAGGTGGGGCTGGG + Exonic
1184158848 22:42686292-42686314 CTGCAGGCACAGCTGGGCCTAGG - Intergenic
1184493729 22:44825460-44825482 CTGTAGACACAACAGAGGCTGGG - Intronic
952944785 3:38472132-38472154 CTGAAGAGACAGATGGGGCCAGG - Intronic
953206776 3:40838257-40838279 CTGGACACACAGGTGGGGTTTGG + Intergenic
953383820 3:42493463-42493485 CTGTGGGCACAGTTGGGCCTAGG + Intronic
954145537 3:48632625-48632647 CAGTAGACACAGGTGGGACAGGG - Intronic
955748259 3:62161702-62161724 CTGTAGCCACAGGAGGGGCATGG + Intronic
956837110 3:73104409-73104431 CAGGAGAGACATTTGGGGCTGGG - Intergenic
956842120 3:73150306-73150328 CTAAAGAAACAGGTGGGGCTGGG - Intergenic
957548735 3:81676235-81676257 CTGTGAACACTGTGGGGGCTAGG - Intronic
957577685 3:82030787-82030809 CTGTAGAGACAGTAGCAGCTGGG + Intergenic
959191223 3:103113615-103113637 CTCTGGACACACTTGGGGCCTGG + Intergenic
959399470 3:105882403-105882425 CTGGAAACTCAGTTGGGCCTGGG - Intergenic
959868463 3:111299660-111299682 CTCTGGACCCAGCTGGGGCTAGG - Intronic
961422242 3:126815648-126815670 CTGTGGACACAGATGGGGGGGGG - Intronic
961772433 3:129259859-129259881 CTGTAGACACAGTAGGAGAGAGG + Intronic
961820612 3:129573867-129573889 CTGGAGGCTCAGGTGGGGCTGGG + Intronic
961826240 3:129600624-129600646 CTGGAGAAACAGATAGGGCTTGG - Intronic
965041098 3:163507985-163508007 CTGGAGAAACAGGTGGGTCTGGG + Intergenic
968264543 3:197352676-197352698 CTGCAGACACAGCGGGGGCAGGG - Intergenic
968676244 4:1882086-1882108 CTGTAGATTGAGTTGGTGCTGGG + Intronic
969210474 4:5683527-5683549 CTGGAGACACAGTTGTGAATAGG + Intronic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
970469267 4:16360516-16360538 ATGTAGACAGAGTTGGAGCTGGG - Intergenic
972659982 4:41106843-41106865 CTGGAGAAATAGTTGGGTCTGGG + Intronic
975728462 4:77315397-77315419 GTGTAAACACAGTTGGGCTTGGG + Intronic
976022502 4:80646134-80646156 CTGGAGGCACTGTTGTGGCTTGG - Intronic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
978290820 4:107137688-107137710 CTATGGTCACAGTGGGGGCTTGG + Intronic
978337628 4:107686802-107686824 CACTAGCCAGAGTTGGGGCTCGG - Intronic
978661865 4:111137011-111137033 TTCTGGACACAGCTGGGGCTTGG - Intergenic
984655101 4:182309018-182309040 CTGTGGAGACAGTAGGGGCTAGG - Intronic
984771531 4:183440849-183440871 CTGCAGACATAGGTGTGGCTGGG - Intergenic
986859292 5:11906463-11906485 CTACAGATACTGTTGGGGCTGGG + Intergenic
987037578 5:14033452-14033474 CTGTAGATACAGCTGGTCCTGGG - Intergenic
987434922 5:17883244-17883266 CTGTGGTCACTGTTGGGGGTAGG + Intergenic
989688704 5:44116776-44116798 TTGTAGAAGGAGTTGGGGCTTGG + Intergenic
991667575 5:69014519-69014541 TTGAAGACAGAGGTGGGGCTGGG - Intergenic
993363620 5:87007677-87007699 CTTAAAACACAGTTGAGGCTGGG - Intergenic
997223151 5:132187066-132187088 CAGTAGGCACCGTTGGAGCTGGG - Intergenic
997410234 5:133685443-133685465 CTGTAGACACAGCGTGTGCTAGG - Intergenic
997435654 5:133872826-133872848 GTCTAGACAGAGGTGGGGCTGGG + Intergenic
998446733 5:142204645-142204667 CTGGAGACACAGTGTGGGGTTGG - Intergenic
998634075 5:143932687-143932709 CTCTGGACACACTTGGGGCCTGG + Intergenic
998877771 5:146618039-146618061 GTGTAGACATATTTGGGGATGGG - Intronic
999431965 5:151532038-151532060 CTGCAGCCACAGGAGGGGCTGGG + Intronic
999897042 5:156045851-156045873 CTGTAGCCACAGTGGGAGTTAGG + Intronic
1000226104 5:159263395-159263417 TTGGAGACGCTGTTGGGGCTCGG + Intronic
1000855065 5:166387995-166388017 CTTTAAACAAAGTTGAGGCTGGG + Intergenic
1001129623 5:169053129-169053151 CTGTAGCTACAGTTGGGAGTTGG + Intronic
1002440253 5:179260638-179260660 CTGTAGAAACAGTGGGAGCCAGG - Intronic
1002560268 5:180076917-180076939 CTGCAGCCACAGCTGGGGGTGGG - Intergenic
1002564194 5:180100716-180100738 CTGTAGCCACAGTTCAGGCATGG - Intergenic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1005259473 6:24042695-24042717 CTGCAGCCACTGTGGGGGCTGGG + Intergenic
1007549606 6:42718958-42718980 CTAAAGACACAATTAGGGCTGGG - Intronic
1008976706 6:57435437-57435459 CTGTAAGCACAGTTTTGGCTGGG - Intronic
1010221067 6:73449698-73449720 CTCAAGACACAGTCTGGGCTGGG + Intronic
1010838976 6:80624645-80624667 CTCTGGACACACTTGGGGCCTGG + Intergenic
1011588947 6:88952239-88952261 CTGTAGCCACTGTAGGGGATGGG - Intronic
1012095606 6:94954876-94954898 CTGTAGATCCAGTTGTGTCTGGG + Intergenic
1012203551 6:96435414-96435436 CTGTAGCCCCTGTTGGGGATGGG + Intergenic
1012356504 6:98320961-98320983 CTGTAGATGCAGTCTGGGCTGGG - Intergenic
1012522075 6:100134104-100134126 CTGTAGACTTACTTGGTGCTTGG - Intergenic
1012591991 6:100993159-100993181 CTTAAGAAACATTTGGGGCTTGG - Intergenic
1015962153 6:138660967-138660989 CTGTAGTCCCAGTTGGGACTGGG + Intronic
1016323144 6:142870115-142870137 CTGCAGACCCAGGTGGGTCTTGG - Intronic
1016622169 6:146123613-146123635 CTGGAGGCACAGTTGGGTATTGG - Intronic
1018156455 6:160989961-160989983 CTGAAGACAAAGTGGGGGCACGG + Intergenic
1019434427 7:1014867-1014889 CTGTAGACAGAATTGGTGCTCGG - Intronic
1019709465 7:2511681-2511703 CTGAAGACAAGGCTGGGGCTGGG - Intergenic
1021172876 7:17417340-17417362 CTGTAGAAAGGGTTGGGGTTTGG - Intergenic
1023048043 7:36228596-36228618 CTGCAGACACAGCTGGGGCCAGG + Intronic
1023317462 7:38954492-38954514 CTTTAGACAGAGTTTTGGCTAGG - Intergenic
1023586578 7:41737332-41737354 CTGTGGACAAAGTTAAGGCTGGG - Intergenic
1027468105 7:78540253-78540275 CTGTAGCCACTGTTGGGGATGGG + Intronic
1028722390 7:94048419-94048441 ATGTGGAGACAGTTGGGGCCAGG + Intergenic
1031313208 7:120225667-120225689 TTGTAGACATAGTTGGACCTAGG - Intergenic
1032246468 7:130217876-130217898 ATCCAGGCACAGTTGGGGCTAGG + Intergenic
1032491976 7:132330598-132330620 ATGCAGACACAGTTGGGGCCTGG - Intronic
1034741296 7:153475967-153475989 CTCTAGAGACAGTTTGGACTTGG + Intergenic
1035058959 7:156055201-156055223 ATGTTGACACAGGTGGGGGTGGG - Intergenic
1035485665 7:159223213-159223235 CAGTAGGCACAGTTAGGGCAGGG + Intergenic
1037516633 8:19638269-19638291 CAGCAGACACAGTTGAGGCAGGG - Intronic
1041653294 8:60322518-60322540 CTGTAGACAAAGTGTGGGCTTGG + Intergenic
1043404416 8:79916062-79916084 CTATAGAAACAATTGGGGGTGGG - Intergenic
1048048052 8:130791773-130791795 CTGTAAACACCTGTGGGGCTCGG - Intronic
1048150727 8:131891002-131891024 TCCTAGACACAGTTGGGGCTGGG - Intergenic
1051873673 9:21768089-21768111 CTGTTTACCCAGTTGGGTCTGGG + Intergenic
1053040137 9:34863171-34863193 CTCTAGACTCACTGGGGGCTTGG + Intergenic
1056304767 9:85279155-85279177 CTGTGGACACAATTTTGGCTAGG + Intergenic
1059029233 9:110672355-110672377 CTGAAGACCCAGCTGGGGCTAGG + Intronic
1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG + Intergenic
1185504707 X:623893-623915 CTGGAGACGCAGGCGGGGCTGGG - Intergenic
1187156919 X:16728740-16728762 ATAAAGACACAGTTGAGGCTGGG + Intronic
1189130855 X:38496595-38496617 CTGTAGACAGAGCTGGGGCCAGG + Intronic
1190773428 X:53533819-53533841 TGCTAGACACAGTGGGGGCTGGG - Intronic
1192236248 X:69297952-69297974 CTGGAGACATATCTGGGGCTGGG - Intergenic
1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG + Intergenic
1198676510 X:139136947-139136969 CTGTTGACATGGTTGGGCCTTGG - Intronic
1199851827 X:151729309-151729331 TTATAGACAAAGATGGGGCTGGG - Intergenic