ID: 1119431152

View in Genome Browser
Species Human (GRCh38)
Location 14:74568837-74568859
Sequence GTACAGAAGGCCAACAGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 135
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 126}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119431146_1119431152 6 Left 1119431146 14:74568808-74568830 CCATCTTGAGAACTATACTTCGG 0: 1
1: 0
2: 0
3: 1
4: 58
Right 1119431152 14:74568837-74568859 GTACAGAAGGCCAACAGTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 126
1119431144_1119431152 27 Left 1119431144 14:74568787-74568809 CCTATACCACGAATCTTTGCACC 0: 1
1: 0
2: 0
3: 2
4: 45
Right 1119431152 14:74568837-74568859 GTACAGAAGGCCAACAGTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 126
1119431145_1119431152 21 Left 1119431145 14:74568793-74568815 CCACGAATCTTTGCACCATCTTG 0: 1
1: 0
2: 0
3: 6
4: 95
Right 1119431152 14:74568837-74568859 GTACAGAAGGCCAACAGTCTGGG 0: 1
1: 0
2: 0
3: 8
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119431152 Original CRISPR GTACAGAAGGCCAACAGTCT GGG Intronic
900560146 1:3300851-3300873 GTGCTGAAGGACAAAAGTCTGGG - Intronic
900617270 1:3571069-3571091 GCACAGACAGCCAACAGCCTGGG + Intronic
902603069 1:17553124-17553146 GAGCAGAAGGCCAGGAGTCTGGG - Intronic
902952431 1:19896784-19896806 GTACAGAAGCCCTAAGGTCTGGG - Intronic
906913733 1:49984293-49984315 GTACAGAAGACCACCAGCCATGG + Intronic
907249190 1:53126687-53126709 GATCAGAAGCCCAACTGTCTGGG - Intronic
907562781 1:55406143-55406165 GTTCAGAAGGCCAGAAATCTAGG - Intergenic
913684410 1:121217772-121217794 GTATAGAAGTCCAGCATTCTAGG + Intronic
914036249 1:144005387-144005409 GTATAGAAGTCCAGCATTCTAGG + Intergenic
914153207 1:145062558-145062580 GTATAGAAGTCCAGCATTCTAGG - Intronic
916249888 1:162726759-162726781 CTACAGAAGAACAACAGTGTTGG + Intronic
920471719 1:206236285-206236307 GTATAGAAGTCCAGCATTCTAGG + Intronic
1065640480 10:27777396-27777418 ATACAGAGGGCCAACTGTATTGG - Intergenic
1069731293 10:70616357-70616379 GTAAAGCAGGCCAACAGCCAGGG - Intergenic
1071399050 10:85251551-85251573 TCACAGAAGGACAACAGTGTGGG - Intergenic
1072497442 10:95976096-95976118 GTACAAAAGACCAACAGCCTAGG - Intronic
1072549220 10:96464489-96464511 GCTCACAAGGCCAACATTCTAGG - Intronic
1073761047 10:106629237-106629259 GTGCAGGTGGACAACAGTCTGGG - Exonic
1074837345 10:117309973-117309995 CTCCAGAGGTCCAACAGTCTTGG + Intronic
1081015905 11:37880147-37880169 GTACAGAAGATCATCAGACTGGG - Intergenic
1081552459 11:44126568-44126590 TTTCAGAAGGCCAACAGTGGTGG + Intronic
1082643467 11:55692443-55692465 GGACAGAAAGCAAACATTCTGGG + Intergenic
1082775302 11:57240193-57240215 GTACAGAATGCCAAGATTCCAGG - Intergenic
1084964476 11:72737354-72737376 GGACAGAAGGGCAAAAGTTTTGG - Intronic
1086077490 11:82869990-82870012 GGACAGAAGGCCAACATTGCAGG + Intronic
1091654745 12:2337372-2337394 CCAGAGAAGGCCTACAGTCTTGG - Intronic
1092010927 12:5111927-5111949 GTAAAAAATGCCACCAGTCTGGG - Intergenic
1092753079 12:11737086-11737108 GTACAGTAGGCCCACAGTCGTGG + Intronic
1092956863 12:13559398-13559420 CTCCACAAAGCCAACAGTCTAGG + Exonic
1095206942 12:39449121-39449143 GTTCAGAAGGGCCACACTCTTGG - Intergenic
1095719540 12:45385721-45385743 GTACAGAAGCACAAATGTCTGGG + Intronic
1099134537 12:78879333-78879355 GTTCAGAAGGCCAGCACTCCTGG + Intronic
1099521177 12:83664913-83664935 TTAAAGAAAGACAACAGTCTGGG + Intergenic
1112040115 13:95538753-95538775 GTACAGCAGGACAACGGTGTTGG - Intronic
1114699701 14:24664517-24664539 GTTCTGTAGGCCAAAAGTCTGGG - Intergenic
1119431152 14:74568837-74568859 GTACAGAAGGCCAACAGTCTGGG + Intronic
1121842151 14:97143708-97143730 GTGCAAAAGGCAGACAGTCTTGG + Intergenic
1123711490 15:22990972-22990994 GGACAGAAGGCCAAAATTCAAGG - Intronic
1125146557 15:36476060-36476082 GTAAACAAGGCAAACAGTCTGGG - Intergenic
1130171212 15:81516467-81516489 GTAAAGAAGGTTAACATTCTGGG + Intergenic
1130845431 15:87739698-87739720 TTTCAGAAAGCAAACAGTCTCGG + Intergenic
1143908086 17:10225816-10225838 GTAGACAAGGACAACAGACTTGG - Intergenic
1144885126 17:18452444-18452466 GTACTGAAGGCAAACTGCCTGGG + Intergenic
1145120444 17:20254717-20254739 GGATAGAAAGCCAAAAGTCTGGG + Intronic
1145147092 17:20491933-20491955 GTACTGAAGGCAAACTGCCTGGG - Intergenic
1145153608 17:20525592-20525614 GTACTGAAGGCAAACTGCCTGGG + Intergenic
1145177021 17:20709290-20709312 GTACTGAAGGCAAACTGCCTGGG + Intergenic
1145177163 17:20711026-20711048 GTACTGAAGGCAAACTGCCTGGG - Intergenic
1145758806 17:27413293-27413315 GTACTGAAGGCAAACTGCCTGGG - Intergenic
1146853212 17:36241191-36241213 GTACTGAAGGCAAACTGCCTGGG + Intronic
1146869120 17:36365081-36365103 GTACTGAAGGCAAACTGCCTGGG + Intronic
1147071994 17:37965712-37965734 GTACTGAAGGCAAACTGCCTGGG + Intergenic
1147083520 17:38045244-38045266 GTACTGAAGGCAAACTGCCTGGG + Intronic
1147099466 17:38169211-38169233 GTACTGAAGGCAAACTGCCTGGG + Intergenic
1147299049 17:39509279-39509301 CTTAAGAGGGCCAACAGTCTGGG - Intronic
1148262935 17:46199917-46199939 GTGGAGAAGACCAACAATCTTGG - Intronic
1149746224 17:59101237-59101259 GAACACAAGGCTAACATTCTTGG + Intronic
1150082481 17:62252500-62252522 GTACTGAAGGCAAACTGCCTGGG + Intergenic
1151991009 17:77574301-77574323 GTGCAGTAGGCCAGCAGGCTGGG + Intergenic
1152108764 17:78345468-78345490 GGCCAGAAGGCCAACACTCAAGG - Intergenic
1154206449 18:12341195-12341217 GTACAGCAGGCCAAGATGCTCGG + Intronic
1159022522 18:63155354-63155376 GTACAGCAAGTCAACAGTATCGG + Intronic
1159232719 18:65629824-65629846 CTCCAGGAGGCCAACAGCCTTGG - Intergenic
1161398216 19:4055921-4055943 GCACAGATGGAAAACAGTCTTGG - Intronic
1164870064 19:31635633-31635655 TTAAAGAAGGCAACCAGTCTCGG - Intergenic
925254951 2:2475476-2475498 GCAGAGAAGGGGAACAGTCTTGG + Intergenic
930184651 2:48400899-48400921 ATTCTGAAGGCCAACATTCTAGG + Intergenic
935772173 2:106436452-106436474 GTACAGAAAGACAAAAATCTTGG - Exonic
935907898 2:107859494-107859516 GTACAGAAAGACAAAAATCTTGG + Exonic
935994294 2:108751643-108751665 GTACAGAAAGACAAAAATCTTGG + Exonic
936129686 2:109824602-109824624 GTACAGAAAGACAAAAATCTTGG + Exonic
936215011 2:110546883-110546905 GTACAGAAAGACAAAAATCTTGG - Exonic
936424148 2:112401446-112401468 GTACAGAAAGACAAAAATCTTGG - Exonic
939290880 2:140193537-140193559 GCACAGAAGGCCAACACGCCTGG - Intergenic
940982579 2:160020042-160020064 GTACTGAAGGCCACCTGTGTTGG - Intronic
942063846 2:172252095-172252117 CCACAGAAAGCCAACAGTCTCGG - Intergenic
943774663 2:191751735-191751757 GTACAGAAGGAAAACTTTCTGGG + Intergenic
946385278 2:219380507-219380529 GTACAGAAGGCCAGGCGTGTTGG - Intronic
946627912 2:221634699-221634721 ATAAAGAAGGACAACAGCCTTGG + Intergenic
946996201 2:225394683-225394705 GTTCAGAATGCCAACATGCTTGG - Intergenic
948289611 2:236815628-236815650 GCACAGATGGGCGACAGTCTTGG + Intergenic
1170147916 20:13197656-13197678 GTACAGAAAGCCAGCAGCCAGGG + Intergenic
1171141135 20:22743854-22743876 GTGAAGAAGGCCAACAGTAATGG - Intergenic
1173335163 20:42106748-42106770 CTACAGGTGGCCAACTGTCTTGG + Intronic
1176955357 21:15096603-15096625 GTACCGAAGACCACCAGGCTGGG + Intergenic
1181981035 22:26766645-26766667 GTTCAGAAAGTCAACAGACTTGG - Intergenic
950819853 3:15745008-15745030 GTACAGAGGGCCAACAAACATGG - Intronic
951067718 3:18286942-18286964 GAACAAAAGCCCAACAGTATTGG + Intronic
952357315 3:32596609-32596631 GTTAAGAAGGCCAAAAGTCTGGG + Intergenic
955666949 3:61359664-61359686 GAACAGAAGACCTACAGTCTAGG - Intergenic
959229951 3:103635427-103635449 GTAAAAATGGCCAACAGTATAGG + Intergenic
960124399 3:113982671-113982693 GGACAGAAGGCCAAGAGTTTTGG - Intronic
964784217 3:160376501-160376523 CTAGAGAAGGCCCACAGTATAGG + Intronic
966944714 3:184769768-184769790 GGACAGATGGCCAGCAGTCTTGG + Intergenic
968026281 3:195445097-195445119 GTAGAGATTGCCAACTGTCTTGG - Intergenic
969970035 4:11037391-11037413 AAAAAGAAGGCCAACACTCTGGG + Intergenic
971630815 4:28991078-28991100 GTTCAGAAGACCAATATTCTGGG + Intergenic
976009560 4:80471161-80471183 GTACTGAAGGCAGAGAGTCTGGG - Intronic
976108060 4:81640561-81640583 GAACTGAAGCCAAACAGTCTTGG + Intronic
980211650 4:129796015-129796037 GCACAGAAGCTCAACAGTTTTGG + Intergenic
983975010 4:173923057-173923079 GTACAGGAGGACAGCAGGCTTGG - Intergenic
993648797 5:90493079-90493101 GTACAGAAGGCATATATTCTAGG + Intronic
996300814 5:121982226-121982248 GTACAGAAGGCTAACAAACCAGG - Intronic
997677476 5:135723971-135723993 GTAGAGAAGACCTCCAGTCTTGG - Intergenic
1005932707 6:30495734-30495756 GTACAAAATGCCAAAAGTCAAGG + Intergenic
1007293461 6:40803875-40803897 TTAAAGAAGGCAAACACTCTAGG - Intergenic
1010327761 6:74585533-74585555 GTACAAAAAGCCAACAATTTGGG - Intergenic
1011509154 6:88080845-88080867 GTACAGAGGGGCAAAAGTTTTGG - Intergenic
1011961633 6:93098094-93098116 TTACAGAAGGCAAACATTCCAGG + Intergenic
1015417626 6:132967713-132967735 GTACAGTAGGCCTACAGCCCAGG + Intergenic
1018447472 6:163870703-163870725 CTACAAAAGGCCTACTGTCTGGG + Intergenic
1021636009 7:22694200-22694222 ATACAAATGGCCAACAGTCATGG + Intergenic
1026109132 7:67444925-67444947 GGACAGAAAGCCAACACCCTGGG + Intergenic
1027460562 7:78447760-78447782 GTACCTAAAGCCAACAGCCTGGG + Intronic
1028581930 7:92417768-92417790 TTAGAGAAGGACAACTGTCTAGG + Intergenic
1030846183 7:114415125-114415147 GCACAAAATGCCATCAGTCTGGG + Exonic
1031298156 7:120031070-120031092 GTACTGAATGCCAATACTCTTGG + Intergenic
1032621826 7:133542083-133542105 CTTCAGAAGGCCAAGGGTCTTGG - Intronic
1034144189 7:148853803-148853825 TTACAGAGGGCCAACTGTATAGG + Intronic
1037805333 8:22055455-22055477 GTACAGAAAGCCGAGAGGCTGGG + Intronic
1038931410 8:32197646-32197668 GGACAATAAGCCAACAGTCTAGG - Intronic
1044389619 8:91634055-91634077 GTTCAGAAAGCCTGCAGTCTTGG - Intergenic
1046342904 8:112881953-112881975 GTACAGAATGTCAACTGTCAAGG + Intronic
1048170822 8:132104649-132104671 GGAAAGAAGGCCAACAGTGATGG + Intronic
1048795197 8:138143260-138143282 GGACAAAAGGCCCACAGACTGGG + Intronic
1052172441 9:25416946-25416968 GTACAGAAGACCGTGAGTCTTGG - Intergenic
1062406252 9:136398006-136398028 GTACAGAAAGACACCAGTGTTGG + Intronic
1187105846 X:16240568-16240590 GTAATGAGGACCAACAGTCTAGG - Intergenic
1187581290 X:20610158-20610180 GTAGAGAAGGCCAATTCTCTTGG - Intergenic
1190777140 X:53562031-53562053 CTGCAGAAAACCAACAGTCTGGG - Intronic
1194868300 X:99096723-99096745 GTTCATAAGGAAAACAGTCTTGG - Intergenic
1195702365 X:107715157-107715179 GTACAGCAGACAAACAGTATGGG - Intronic
1197149590 X:123205610-123205632 CTACAAAAGCACAACAGTCTGGG + Intronic
1197446402 X:126555382-126555404 GTTCAGAATGCCAAGAGCCTGGG + Intergenic
1201526559 Y:14942313-14942335 TTACAGAAGGTCAACAGACCTGG + Intergenic