ID: 1119432153

View in Genome Browser
Species Human (GRCh38)
Location 14:74575489-74575511
Sequence TCACAGAGACTATAATGTGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 235
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 207}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119432149_1119432153 26 Left 1119432149 14:74575440-74575462 CCACATACAGCTGCACAGGCTGT 0: 1
1: 1
2: 6
3: 38
4: 215
Right 1119432153 14:74575489-74575511 TCACAGAGACTATAATGTGAAGG 0: 1
1: 0
2: 1
3: 26
4: 207

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119432153 Original CRISPR TCACAGAGACTATAATGTGA AGG Intronic
902633240 1:17718306-17718328 TCACAGGGACGACAATGGGATGG + Intergenic
903133664 1:21295014-21295036 TCACAGATGCTATAATGTAGTGG + Intronic
904214696 1:28910277-28910299 TCAAACAGGCTATAATGGGATGG - Intronic
904324409 1:29718682-29718704 TCACAGAGACAAAAATGTGGGGG - Intergenic
907759810 1:57346341-57346363 TCAAAGAGATTTTGATGTGAAGG + Intronic
909295573 1:73943834-73943856 TCACATAGATAATAATATGAAGG + Intergenic
913923895 1:124867422-124867444 TCACAGAAACTACTTTGTGATGG + Intergenic
913924012 1:124868950-124868972 TCACAGAAACTACTTTGTGATGG + Intergenic
913924504 1:124875072-124875094 TCACAGAAACTACTTTGTGATGG + Intergenic
913926951 1:124905687-124905709 TCACAGAAACTACTTTGTGATGG + Intergenic
916999249 1:170338376-170338398 TGACAAATACTATAATTTGACGG - Intergenic
917931764 1:179827408-179827430 TCACAGTAACTAAAATGTGGAGG - Intergenic
920170281 1:204067772-204067794 TCACAGAGCCTATAGTCTAAAGG + Intergenic
920231998 1:204476756-204476778 TCACATAGAATACAATGTGTGGG - Intronic
920878889 1:209862200-209862222 TCACAGAGATTATCATTTGAAGG - Intergenic
921005630 1:211090869-211090891 TCACAGTGACTATTCAGTGAGGG + Intronic
921496450 1:215847818-215847840 TCACCAAGACTTTAATGTAAAGG - Intronic
921694254 1:218189393-218189415 TCACAGAAAATATAATGAAAGGG - Intergenic
923831553 1:237563493-237563515 TCACAGATACTATCATGCAAGGG - Intronic
1064443777 10:15375598-15375620 TCACAGAGATTGAAATATGAGGG - Intergenic
1065450378 10:25850205-25850227 TCCCAGACACTATAAAGTGAAGG - Intergenic
1066093872 10:32054839-32054861 TCAGTGAGACCAGAATGTGAGGG - Intronic
1069306600 10:66978869-66978891 TCACAAAGCCTATTATTTGAAGG + Intronic
1069950939 10:72017617-72017639 TCACAGAGAAGATATTGTGTTGG - Intergenic
1070448662 10:76535001-76535023 TCACAGACACTATAATCTGCTGG - Intronic
1071894670 10:90052683-90052705 TCGCAGAGAATATAGTGTTAGGG - Intergenic
1072020495 10:91394627-91394649 TCTCATAGAATACAATGTGAAGG + Intergenic
1072434005 10:95398915-95398937 TTACAGAGACGATGGTGTGATGG + Intronic
1072528417 10:96295504-96295526 TCTCAGAGAGAATAATTTGATGG - Intergenic
1073628986 10:105129018-105129040 TCACAGATGTTACAATGTGAAGG + Intronic
1081858602 11:46319262-46319284 TCACACAGACTATGAGGTCATGG + Intronic
1082156934 11:48833464-48833486 TCTCAGAGACTACTTTGTGATGG + Intergenic
1083350138 11:62022190-62022212 TCACAGAGACTAGCTTGTGAAGG + Intergenic
1085137009 11:74100185-74100207 TCACATACATTATAAAGTGAAGG - Intronic
1085571510 11:77561929-77561951 TCACAGAGAGTGTAGAGTGATGG - Intronic
1091891069 12:4055023-4055045 TCACAGAGACTCAAGTGTGCTGG - Intergenic
1094879265 12:34697722-34697744 TCTCAGAAACTAATATGTGATGG + Intergenic
1094949844 12:35907811-35907833 TCACAGAAACTACTTTGTGATGG + Intergenic
1094998639 12:36696137-36696159 TCACAGAAACTACTTTGTGATGG + Intergenic
1094998894 12:36700210-36700232 TCACAGAAACTACTTTGTGATGG + Intergenic
1095004496 12:36791366-36791388 TCACAGAAACTACTTTGTGATGG + Intergenic
1095021161 12:37061277-37061299 TCACAGAAACTACTTTGTGATGG + Intergenic
1095022177 12:37077587-37077609 TCACAGAAACTACTTTGTGATGG + Intergenic
1095030680 12:37272381-37272403 TCTCAGAAACTATATTGTGATGG + Intergenic
1095030783 12:37274251-37274273 TCTCAGAAACTACATTGTGATGG + Intergenic
1095384117 12:41630153-41630175 TCACAGAGGCAAGAAAGTGAGGG + Intergenic
1097778224 12:63672371-63672393 TCACACAGGCTAAAGTGTGATGG + Intergenic
1098465938 12:70785113-70785135 TCACAGAAGCCATAATGTGAAGG - Intronic
1099901580 12:88717017-88717039 CCATAAAGACTATGATGTGAAGG - Intergenic
1103195176 12:119037477-119037499 TCATCCAGACTATAATGTGATGG - Intronic
1107461686 13:40609912-40609934 TGACAGCAACTGTAATGTGAAGG - Intronic
1107998700 13:45887311-45887333 TCAAAGAATCTATAATGTAATGG + Intergenic
1109326480 13:60873367-60873389 ACTCAGAGACCAAAATGTGAAGG + Intergenic
1111850769 13:93571702-93571724 TCACATGGAATATAATTTGAAGG + Intronic
1112636080 13:101219542-101219564 GCACAGAGACTATCAGGTGCTGG + Intronic
1112928280 13:104704272-104704294 TCACAGAGCCAAAAAAGTGAAGG - Intergenic
1113186731 13:107695393-107695415 TCACAGTGACTATAACCTTACGG - Intronic
1114476774 14:23000996-23001018 TCCCAGTGACTATAATGACAAGG - Intronic
1114821211 14:26021311-26021333 TCACAGTCACTATAAGTTGATGG + Intergenic
1115040029 14:28912716-28912738 TCATAGATTCTATAATGTTAAGG - Intergenic
1117275550 14:54189504-54189526 CTACAGAGACCCTAATGTGAGGG - Intergenic
1119432153 14:74575489-74575511 TCACAGAGACTATAATGTGAAGG + Intronic
1119432363 14:74576654-74576676 TCACAGAGAGTATGATATGATGG + Intronic
1119831814 14:77709842-77709864 CCACAGAGACTAAATTTTGAAGG - Intronic
1120603271 14:86539414-86539436 TCCCAGAGAATATTATCTGAAGG + Intergenic
1122630733 14:103106684-103106706 TCACTTAGACTACAATGTGAAGG - Intronic
1124037574 15:26070026-26070048 TAACAGAGCTTATAATGTGGTGG - Intergenic
1125192391 15:37008966-37008988 TCACAGAGACCATACTTTTATGG - Intronic
1125462788 15:39921753-39921775 TCACATAGATTACTATGTGAAGG - Intergenic
1129638844 15:77352971-77352993 TCACTGAGTATTTAATGTGAGGG - Intronic
1130237506 15:82150204-82150226 TCACAAAAACCTTAATGTGATGG + Intronic
1132312744 15:100869116-100869138 TCAAAGAGTCTGTAATGTAATGG - Intergenic
1133491288 16:6271732-6271754 TCACAGTGAGTAAAATATGATGG - Intronic
1135818824 16:25660846-25660868 TCTCAGAGACTAATATGTGCTGG - Intergenic
1139295415 16:65896189-65896211 GCACTGAGACTATCAAGTGAAGG - Intergenic
1140645239 16:77022858-77022880 TCACCCAGACTAGAGTGTGATGG - Intergenic
1144051435 17:11500354-11500376 TTACAGAGACTGCAATGGGAAGG - Intronic
1144114513 17:12074314-12074336 TCCCAGAGATTATTGTGTGATGG + Intronic
1145670151 17:26434232-26434254 TCACAGAGAATTTTCTGTGAAGG - Intergenic
1148990194 17:51659286-51659308 TCCCAGAGTCTAAAATCTGAAGG - Intronic
1149540193 17:57462859-57462881 TGACAGAGACTATAACAGGAAGG - Intronic
1153578499 18:6547450-6547472 TCACAGATGATATAATGTGATGG - Intronic
1158169472 18:54580583-54580605 TCACAGAAATTACAATGTGGTGG + Intergenic
1158315328 18:56205854-56205876 TCCTAGAGACTAAAAAGTGATGG - Intergenic
1166683288 19:44781146-44781168 TCCCAGAGCCTATGATGGGAGGG - Intronic
925867807 2:8244376-8244398 TCAAAGTGATTATGATGTGAGGG - Intergenic
926677002 2:15633291-15633313 TCACAAATACTATCATATGAAGG - Intergenic
927914119 2:26923619-26923641 TCACAAAGACTCTCATGTTATGG + Intronic
927977055 2:27346732-27346754 TCACCCAGACTAGAATGTGGTGG + Intronic
928761504 2:34588461-34588483 TCACAGAGCTTAAAATGTAATGG - Intergenic
932555877 2:72824906-72824928 TCACAGAGAAAATAAAGTGGGGG - Intronic
933093796 2:78153035-78153057 TCACAGAGATTATACTTTAATGG + Intergenic
933167633 2:79093572-79093594 TCAAAGAGACTATAAAAAGAGGG + Intergenic
938924960 2:136030532-136030554 TTATAGAAACTATGATGTGAAGG - Intergenic
939501072 2:142985218-142985240 TCACATTGACTTTAATCTGAAGG + Intronic
940048786 2:149438701-149438723 TCACATAGTCTACAAAGTGAAGG + Intronic
940070387 2:149680106-149680128 TCTCAATGACTATAATGTTAAGG - Intergenic
944506903 2:200422085-200422107 TCACAGAAAGTTTCATGTGAGGG - Intronic
945111994 2:206368742-206368764 TCACTCAGAATATAATGTGAGGG + Intergenic
945464810 2:210156442-210156464 AAACAGAGAATAAAATGTGATGG + Intronic
945700031 2:213157976-213157998 TTAGAGAGACTATAGTATGATGG - Intergenic
945818163 2:214630926-214630948 TCACAGAGACTGTAGTATTATGG + Intergenic
947035090 2:225843831-225843853 TCAGACAGAATAAAATGTGAGGG + Intergenic
947412725 2:229858528-229858550 ACACAGACACTAAAATGTGATGG + Intronic
948623957 2:239256093-239256115 CCACACAGACTACAAAGTGATGG - Intronic
948813279 2:240496662-240496684 TCACAGTGACCCTAAGGTGACGG + Intronic
1169883370 20:10371240-10371262 TCAGAGATATTAAAATGTGAGGG + Intergenic
1174308801 20:49634494-49634516 CGACAGAGACTACAATTTGAGGG + Exonic
1175733609 20:61370707-61370729 TTACAGAGACTGTAATGAGGAGG + Intronic
1176323054 21:5353014-5353036 TCAAAGAGAATAAAATGTGTAGG + Intergenic
1176480707 21:7284634-7284656 TCAAAGAGAATAAAATGTGTAGG + Intergenic
1179305230 21:40147907-40147929 ACAGAGAAACTATATTGTGAAGG - Intronic
1180504091 22:15975004-15975026 TCTCAGAAACTACATTGTGATGG + Intergenic
1182382152 22:29900257-29900279 CCAAAGAAACAATAATGTGAAGG - Intronic
1182770816 22:32795030-32795052 TCACATAGAATACAATGAGATGG - Intronic
1185328439 22:50239522-50239544 TCTCAGAGTCTTTAATGTGGTGG - Intronic
1203334486 22_KI270739v1_random:47508-47530 TCTCAGAAACTACATTGTGATGG - Intergenic
950845664 3:16013320-16013342 TGACAGGGAGTTTAATGTGAAGG - Intergenic
951927672 3:27925938-27925960 TCACAGAACTTATAATGTCAAGG - Intergenic
952708086 3:36400366-36400388 TCACTGAAAATATAATGTAAAGG + Intronic
953015196 3:39067959-39067981 TCAAAGAGACACTAATGGGAGGG + Intronic
953242518 3:41162204-41162226 TCACAGTGAATAGAAGGTGAGGG + Intergenic
955233897 3:57123084-57123106 TCACAGAGACTTTATTTGGAGGG - Intronic
955847238 3:63178892-63178914 TCCCAGAGACTATGATTTAATGG - Intergenic
956180055 3:66509120-66509142 TCAGAGAGTTTATAATCTGATGG + Intergenic
958019183 3:87977760-87977782 TCACACACACTATTATGTGGGGG + Intergenic
958199275 3:90287756-90287778 TCTGAGAAACTATTATGTGATGG - Intergenic
958403280 3:93716992-93717014 TCTCAGAAACTACATTGTGATGG - Intergenic
959636350 3:108576831-108576853 TCACATAGAATATAATGCTAGGG - Intronic
960694592 3:120383674-120383696 TCACATAGACTCTAATGTGATGG + Intergenic
960742980 3:120855370-120855392 TCACAGATGCTATAAAGGGAAGG - Intergenic
965976568 3:174631296-174631318 TCACATAGACTACAGTGAGAAGG - Intronic
967811092 3:193761835-193761857 TCTCAGAACATATAATGTGATGG + Intergenic
969593449 4:8134612-8134634 TCACAGAGACACAAATGTGCCGG + Intronic
970398254 4:15692953-15692975 ACACAGAGAAAATAATGTGATGG - Intronic
971082186 4:23226379-23226401 TGACAGAGCCTATAAAATGAGGG + Intergenic
971957776 4:33444680-33444702 AACCAGAGACTATAATTTGAAGG - Intergenic
972830881 4:42812219-42812241 TCACACTGACTAAAATGTGATGG - Intergenic
974108744 4:57501360-57501382 TGACAGAGACTAAATTCTGAAGG + Intergenic
975253346 4:72205680-72205702 TCACATGGACTATAAGTTGAAGG + Intergenic
975879868 4:78891879-78891901 TTACTGAGTCTAAAATGTGATGG + Intronic
977346353 4:95821475-95821497 TCACAGAGAGGAAAATGTCAGGG + Intergenic
977791524 4:101110044-101110066 TCAAAGATACCATAATGTGGTGG - Intronic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979545486 4:121935261-121935283 TCAGAAAGATTATAATGTAATGG - Intronic
979551351 4:121994719-121994741 TCACAGAGACTATAAAGGAGAGG + Intergenic
979895678 4:126153627-126153649 TCACATAGACTTTCATGTAACGG - Intergenic
980336384 4:131479205-131479227 TGAGAGAGACTATAAAGTGAAGG - Intergenic
980813917 4:137918559-137918581 TCAAAGAAACTAAAATGGGAAGG + Intergenic
980835529 4:138187187-138187209 TCAGAGAGACTGTAATGTCTAGG - Intronic
981410108 4:144419768-144419790 CCACAGACATTTTAATGTGAGGG + Intergenic
982326038 4:154129017-154129039 CCACAGAGACCACAAAGTGAGGG + Intergenic
982699862 4:158648365-158648387 ATACAAAGACTATAATGTGTGGG - Intronic
982900682 4:160998167-160998189 TCACAGAGAAAATAATATGAAGG - Intergenic
982981157 4:162137370-162137392 TTACAGAGATTATAATTAGAAGG + Intronic
983643768 4:169969172-169969194 GCACAGAGACAATAAGGAGAAGG + Intergenic
983838784 4:172428660-172428682 TTACAGAGAACATGATGTGAAGG - Intronic
984494941 4:180484872-180484894 TCATAAAGACTATAATTTCAGGG - Intergenic
985325551 4:188764940-188764962 TCACTGAGTCTTTAATTTGACGG - Intergenic
987564567 5:19567270-19567292 TCATAGAGAATATAATGTCTAGG - Intronic
989862669 5:46400127-46400149 TCACAGAAACTTCTATGTGATGG + Intergenic
990170290 5:53040154-53040176 CAACAGAGACTCTAATTTGAAGG + Intronic
990491234 5:56304963-56304985 ACAGAGAGACGATCATGTGAAGG - Intergenic
991261145 5:64669674-64669696 TCACACATACTATGATCTGATGG + Intergenic
991339137 5:65586547-65586569 TCAGAGATACTAAAATGTGGGGG - Intronic
991718674 5:69475841-69475863 TCACAGAGACTAGAGTGGGAGGG - Intergenic
991719281 5:69480531-69480553 TCACAGAGACTAGAGTGGGAGGG + Intergenic
993154086 5:84199583-84199605 ACAAAGAGAAAATAATGTGAGGG + Intronic
993283115 5:85953183-85953205 CCACAGTGGCTATAATGAGAAGG + Intergenic
993539839 5:89135167-89135189 TCCCAGAGACTATGCTGTGTTGG - Intergenic
993579187 5:89638405-89638427 TAACAGAGAATTTAAAGTGATGG - Intergenic
993628196 5:90251565-90251587 TCTCAGAGACTTAAAGGTGATGG - Intergenic
995930057 5:117430586-117430608 TCAAAGAGAATATAATCTTAAGG - Intergenic
996496592 5:124164222-124164244 CCACATAGACAACAATGTGAGGG + Intergenic
997472781 5:134125904-134125926 TCATAGAGACCATAAGGAGAGGG - Intronic
999379087 5:151107538-151107560 TCAGAGACACTAAAATGTGGGGG - Intronic
1000272781 5:159702528-159702550 ACACAGAGACTAAAATCTGAAGG + Intergenic
1001760566 5:174204674-174204696 TCATAGAGACTATGCTGTGACGG + Intronic
1002096858 5:176836487-176836509 TCACAGAGACGACAGTGTGTAGG + Intronic
1003750604 6:9050852-9050874 CCATAGAGATTAAAATGTGATGG - Intergenic
1007332795 6:41126829-41126851 TTACAGAGGCTATGATATGATGG + Intergenic
1009082198 6:58789063-58789085 TCTCAGAAACTAATATGTGATGG + Intergenic
1009086371 6:58847115-58847137 TCTCAGAAACTAATATGTGATGG + Intergenic
1009099752 6:59033504-59033526 TCTCAGAAACTAAAGTGTGATGG + Intergenic
1012616847 6:101288025-101288047 TCTCAGGGACTATAAGTTGAAGG - Intergenic
1012763916 6:103339840-103339862 ACAGAGAGAAAATAATGTGATGG - Intergenic
1014167721 6:118244829-118244851 TCACATACACGATACTGTGAAGG - Intronic
1017588999 6:155958669-155958691 TCACATAGTCTCTGATGTGAAGG - Intergenic
1017942137 6:159062201-159062223 TCCCAGAGACTACAACGGGAGGG + Intergenic
1021381341 7:19970250-19970272 GCACAGAGTCTAGAATGTGGGGG - Intergenic
1021623750 7:22572714-22572736 TCAGAGAGAAGATGATGTGAAGG - Intronic
1022701568 7:32765465-32765487 TCACACAGGCTAAAGTGTGATGG + Intergenic
1022892045 7:34711365-34711387 TCATAGAGAGGATAATTTGAAGG - Intronic
1022937155 7:35190039-35190061 TCACACAGGCTAAAGTGTGATGG + Intergenic
1026136111 7:67662490-67662512 ACACAGGGACAATATTGTGAGGG - Intergenic
1026285942 7:68962847-68962869 TCACATGGACTATAGTGTGAAGG + Intergenic
1027719682 7:81724439-81724461 TCACATAGACTTAATTGTGATGG - Intronic
1028072589 7:86470074-86470096 GGACAGAGACCAGAATGTGAAGG - Intergenic
1028372972 7:90115560-90115582 TCACACAGGCTAAAGTGTGATGG - Intergenic
1029833316 7:103282681-103282703 TCACACAGGCTAAAGTGTGATGG + Intergenic
1030554165 7:111002554-111002576 TGTCAGAGGCTATAATGAGAAGG + Intronic
1031196608 7:118622900-118622922 TCACAGTGCCTATACTGTGTTGG - Intergenic
1033020647 7:137721165-137721187 TCACACAGAATACAATGTGGAGG - Intronic
1033510947 7:142059734-142059756 TCACAGAAACTCTACTGTGCAGG + Intronic
1033813058 7:145040090-145040112 TCATAGAGAAGATAATTTGAAGG + Intergenic
1033823322 7:145160066-145160088 ACACAGTGACTCAAATGTGATGG + Intergenic
1034521619 7:151625061-151625083 TCACAGAGCTTACAATGTAATGG + Intronic
1035125102 7:156602862-156602884 TCACAGAGACAAACAGGTGAAGG - Intergenic
1036715568 8:11120442-11120464 TCACAGAGAATAAAATGTCTAGG + Intronic
1037093473 8:14952648-14952670 TCACAGAGACTATCTCCTGAGGG - Intronic
1037483174 8:19324071-19324093 TGACAGTGACTTTTATGTGAAGG + Intronic
1038219044 8:25590203-25590225 TCACAGAGACTACAATACCAAGG - Intergenic
1039070288 8:33643463-33643485 TCATACAGAATATAATGTAAAGG - Intergenic
1043710785 8:83415768-83415790 GCACAGGGACTATCTTGTGATGG - Intergenic
1044309557 8:90678076-90678098 TGTCAGAGACTAGAATGTCAGGG + Intronic
1047260638 8:123256523-123256545 TCACAGATACTAAAATATTATGG + Intronic
1048826823 8:138436001-138436023 TCACAGATAGTATAGTCTGAAGG - Intronic
1052396785 9:27948820-27948842 ACAAAGAGACAGTAATGTGAGGG + Exonic
1054917075 9:70504615-70504637 TCACAGACACTATGATCTCAGGG + Intergenic
1055891263 9:81126570-81126592 TTTAAGAGACTAAAATGTGAGGG - Intergenic
1060061572 9:120465201-120465223 ACACAGAGCCTATAATCAGAGGG + Intronic
1060317187 9:122523312-122523334 AGACAAAGACTATATTGTGAGGG + Intergenic
1192706917 X:73536125-73536147 TCATAGAGAGAATAATTTGAAGG - Intergenic
1193579287 X:83243711-83243733 TCACAGATAAAATAATGTGCAGG - Intergenic
1195247923 X:103013224-103013246 TCACAGAGACTATAATAAACGGG - Intergenic
1195466816 X:105188542-105188564 GCACAGATTCTATAATGAGAGGG + Intronic
1195929081 X:110055371-110055393 TCACATAGACTATAATTGAATGG + Intronic
1196972842 X:121128539-121128561 TCACAGAGGCTATAATCTACTGG - Intergenic
1199737408 X:150696733-150696755 TCACAGCGATTAAAAAGTGAGGG - Intronic
1200684623 Y:6247323-6247345 TCAAAGAGACTTTAATGGAAGGG - Intronic
1200791726 Y:7305211-7305233 TCAATGAGGCTATAAGGTGAAGG - Intergenic
1202275130 Y:23110012-23110034 TCACATGGACTACAATGTGAAGG - Intergenic
1202290898 Y:23310677-23310699 TCACATGGACTACAATGTGAAGG + Intergenic
1202428121 Y:24743734-24743756 TCACATGGACTACAATGTGAAGG - Intergenic
1202442670 Y:24926357-24926379 TCACATGGACTACAATGTGAAGG + Intergenic