ID: 1119434042

View in Genome Browser
Species Human (GRCh38)
Location 14:74586340-74586362
Sequence CTATATGGCCAGCTGCAGAG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 239
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 211}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119434039_1119434042 2 Left 1119434039 14:74586315-74586337 CCTCTGATCTCTGGACAACCAAA 0: 1
1: 0
2: 0
3: 8
4: 157
Right 1119434042 14:74586340-74586362 CTATATGGCCAGCTGCAGAGTGG 0: 1
1: 0
2: 1
3: 26
4: 211
1119434032_1119434042 30 Left 1119434032 14:74586287-74586309 CCATCCACAGACCCCCAGGACTT 0: 1
1: 1
2: 3
3: 44
4: 309
Right 1119434042 14:74586340-74586362 CTATATGGCCAGCTGCAGAGTGG 0: 1
1: 0
2: 1
3: 26
4: 211
1119434037_1119434042 16 Left 1119434037 14:74586301-74586323 CCAGGACTTGTTCACCTCTGATC 0: 1
1: 0
2: 2
3: 8
4: 107
Right 1119434042 14:74586340-74586362 CTATATGGCCAGCTGCAGAGTGG 0: 1
1: 0
2: 1
3: 26
4: 211
1119434035_1119434042 18 Left 1119434035 14:74586299-74586321 CCCCAGGACTTGTTCACCTCTGA 0: 1
1: 1
2: 0
3: 21
4: 269
Right 1119434042 14:74586340-74586362 CTATATGGCCAGCTGCAGAGTGG 0: 1
1: 0
2: 1
3: 26
4: 211
1119434034_1119434042 19 Left 1119434034 14:74586298-74586320 CCCCCAGGACTTGTTCACCTCTG 0: 1
1: 0
2: 1
3: 12
4: 208
Right 1119434042 14:74586340-74586362 CTATATGGCCAGCTGCAGAGTGG 0: 1
1: 0
2: 1
3: 26
4: 211
1119434033_1119434042 26 Left 1119434033 14:74586291-74586313 CCACAGACCCCCAGGACTTGTTC 0: 1
1: 1
2: 1
3: 25
4: 245
Right 1119434042 14:74586340-74586362 CTATATGGCCAGCTGCAGAGTGG 0: 1
1: 0
2: 1
3: 26
4: 211
1119434036_1119434042 17 Left 1119434036 14:74586300-74586322 CCCAGGACTTGTTCACCTCTGAT 0: 1
1: 0
2: 0
3: 4
4: 136
Right 1119434042 14:74586340-74586362 CTATATGGCCAGCTGCAGAGTGG 0: 1
1: 0
2: 1
3: 26
4: 211

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119434042 Original CRISPR CTATATGGCCAGCTGCAGAG TGG Intronic
900235251 1:1586246-1586268 CAGGATGACCAGCTGCAGAGAGG + Intergenic
900996459 1:6125854-6125876 CTGTCTGGCCCCCTGCAGAGTGG - Exonic
901403528 1:9031314-9031336 CAGGATGACCAGCTGCAGAGAGG - Intergenic
901936636 1:12631253-12631275 CTGGATGACCAGCTGCAGAGAGG + Intergenic
902924419 1:19686668-19686690 ATATGTGTCCTGCTGCAGAGGGG - Intronic
906132407 1:43468579-43468601 CCCAATGACCAGCTGCAGAGAGG - Intergenic
907152984 1:52306256-52306278 CGGGATGACCAGCTGCAGAGAGG + Intronic
907252947 1:53155164-53155186 CTGGATGATCAGCTGCAGAGAGG + Intergenic
907761847 1:57368505-57368527 CTGGATGACCAGCTGCAGAGAGG + Intronic
909962817 1:81868468-81868490 CTCCATGGCAAGCTGGAGAGAGG - Intronic
911025043 1:93427081-93427103 CAGGATGACCAGCTGCAGAGAGG + Intergenic
912942994 1:114061331-114061353 CAGGATGACCAGCTGCAGAGAGG + Intergenic
912953803 1:114138491-114138513 CTATACGGCAGGCAGCAGAGTGG + Intronic
916648807 1:166816438-166816460 CAAGATGACCAGCTGCAGAGAGG - Intergenic
919083229 1:192891346-192891368 CAGGATGACCAGCTGCAGAGAGG - Intergenic
920452876 1:206073290-206073312 CTACATTGCCAGCAGCAGACAGG + Intronic
921097838 1:211902117-211902139 CAGGATGACCAGCTGCAGAGTGG + Intergenic
921097859 1:211902258-211902280 CAGGATGACCAGCTGCAGAGAGG + Intergenic
922861339 1:228818883-228818905 CTGGATGGCCAGCAGCAGAGAGG + Intergenic
922865980 1:228861906-228861928 CTCTCTGGCCAGATGCAGATAGG - Intergenic
923881995 1:238113691-238113713 CTTTAAGGCCAGTTCCAGAGAGG - Intergenic
1067715811 10:48690736-48690758 CTGGATGACCAGCTGCAGGGAGG - Intronic
1068945943 10:62728967-62728989 CTTTGTCTCCAGCTGCAGAGGGG + Intergenic
1069822167 10:71234937-71234959 CTATCTGGCCTGCTGGGGAGGGG - Intronic
1070476773 10:76836594-76836616 CTGTCTGGCCACCTGCAGTGGGG - Intergenic
1072335525 10:94395094-94395116 CAAGATGACCAGCTTCAGAGAGG - Intergenic
1073179917 10:101577529-101577551 CTCTATGGCCTGCTGCACACTGG + Intronic
1073547583 10:104364683-104364705 CTAAATGGCCATCTGCTCAGGGG - Intronic
1074396620 10:113103338-113103360 CTATGTTGCCAATTGCAGAGAGG - Intronic
1074991520 10:118712754-118712776 TGAGATGACCAGCTGCAGAGAGG - Intronic
1075746938 10:124734619-124734641 CTCTAGGGCCAGCACCAGAGGGG + Intronic
1076549120 10:131266837-131266859 CAGGATGACCAGCTGCAGAGAGG - Intronic
1076587794 10:131561108-131561130 CTCCAGGGGCAGCTGCAGAGTGG - Intergenic
1076807614 10:132866833-132866855 CTTTATGGGCAAATGCAGAGGGG + Intronic
1076866510 10:133168933-133168955 CTGTGTGGCCGGCTGGAGAGGGG + Intronic
1077478447 11:2802037-2802059 CGATTTCGCCAGCTGCGGAGCGG + Intronic
1078042755 11:7883909-7883931 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1082305224 11:50564189-50564211 CTAAGTGGCCAACTGCAGAATGG + Intergenic
1083066761 11:59931971-59931993 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1083235678 11:61349371-61349393 CTGCATGGTGAGCTGCAGAGTGG + Exonic
1084026548 11:66453902-66453924 CTCTCTGGACAGTTGCAGAGGGG + Intronic
1084991165 11:72926431-72926453 TGGGATGGCCAGCTGCAGAGAGG + Intronic
1086092803 11:83020941-83020963 CAGGATGACCAGCTGCAGAGAGG + Intronic
1087078298 11:94146062-94146084 AGAAATGGCCAGTTGCAGAGTGG + Intronic
1088704254 11:112447754-112447776 CCTAATGACCAGCTGCAGAGAGG - Intergenic
1090137010 11:124209581-124209603 TGAGATGACCAGCTGCAGAGAGG - Intergenic
1092337738 12:7648617-7648639 CTGGATGACCAGATGCAGAGAGG - Intergenic
1092501436 12:9051298-9051320 CCAAGAGGCCAGCTGCAGAGAGG + Intergenic
1093939346 12:25035940-25035962 CTAAAAGGCCAGCTTCAGAAAGG - Intronic
1094685737 12:32712495-32712517 CCTAATGGCCAGGTGCAGAGTGG + Intronic
1096944667 12:55391869-55391891 CTAGAGGACCAGCTGAAGAGAGG - Intergenic
1099178334 12:79449138-79449160 CTATATGGGCAAATGCAGAAAGG - Exonic
1100504794 12:95208864-95208886 CCAGATGGCCAGCTGCAGCTTGG - Exonic
1100826699 12:98481495-98481517 CTATAAGCCCAGCTACTGAGGGG + Intergenic
1103669403 12:122599905-122599927 CTATTTGGGAAGCTGAAGAGGGG + Intronic
1106308945 13:28535723-28535745 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1106550091 13:30763555-30763577 CGTTATGGGCAGCTGCAGAGAGG + Intronic
1107147077 13:37070500-37070522 CGGGATGACCAGCTGCAGAGAGG + Intergenic
1109470672 13:62799729-62799751 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1109525274 13:63566709-63566731 CCAGACGACCAGCTGCAGAGAGG + Intergenic
1109982307 13:69924425-69924447 TTGGATGGCCAGCTGCAGAAAGG + Intronic
1111337202 13:86839836-86839858 TGAAATGACCAGCTGCAGAGAGG - Intergenic
1111337213 13:86839946-86839968 TGAAATGACCAGCTGCAGAGAGG - Intergenic
1115086931 14:29528058-29528080 TTAGATGGCCAGCTTCACAGTGG + Intergenic
1117954625 14:61112947-61112969 CAACAGAGCCAGCTGCAGAGGGG - Intergenic
1118410063 14:65469762-65469784 CCAGATGACTAGCTGCAGAGAGG - Intronic
1119434042 14:74586340-74586362 CTATATGGCCAGCTGCAGAGTGG + Intronic
1120741385 14:88112273-88112295 GTTTATGGCCAAGTGCAGAGAGG + Intergenic
1121732663 14:96197408-96197430 CTACAAGGCAAGCAGCAGAGCGG - Intergenic
1124651361 15:31476633-31476655 CTGGCTGGACAGCTGCAGAGAGG + Exonic
1126156856 15:45574042-45574064 CAGGATGGCCAGCTGCATAGAGG - Intergenic
1126185696 15:45829170-45829192 TGAGACGGCCAGCTGCAGAGAGG - Intergenic
1126352844 15:47763217-47763239 ACATAGGGCCAACTGCAGAGAGG + Intronic
1128496126 15:68199639-68199661 CTGTATGACAAGCAGCAGAGGGG - Exonic
1129377704 15:75144677-75144699 CATGATGACCAGCTGCAGAGAGG - Intergenic
1131652043 15:94410659-94410681 GTATATTGCAAGCTGCAGAAAGG + Intronic
1136741362 16:32531880-32531902 CTAAATGGCCATTTGCAGAATGG + Intergenic
1136872806 16:33824178-33824200 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1136872813 16:33824234-33824256 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1137282672 16:46992018-46992040 CTCTAGGGCCTGCTGCAGAGAGG - Intergenic
1137698406 16:50478359-50478381 CTGGACGACCAGCTGCAGAGAGG - Intergenic
1138551128 16:57749102-57749124 AGACAGGGCCAGCTGCAGAGGGG + Intronic
1139966521 16:70748558-70748580 CTTTGGGGCCAGCTCCAGAGTGG + Intronic
1203028241 16_KI270728v1_random:543354-543376 CTAAATGGCCATTTGCAGAATGG - Intergenic
1203043480 16_KI270728v1_random:791077-791099 CTAAATGGCCATTTGCAGAATGG + Intergenic
1203099358 16_KI270728v1_random:1291820-1291842 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1203099365 16_KI270728v1_random:1291876-1291898 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1143855891 17:9848638-9848660 AAATATGGCCATTTGCAGAGGGG - Intronic
1148386252 17:47237256-47237278 GGAGATGACCAGCTGCAGAGAGG - Intergenic
1148680750 17:49472323-49472345 CTAGCTGTCCAGCTGCAGGGAGG - Intronic
1149160387 17:53686750-53686772 CTGGATGACAAGCTGCAGAGAGG - Intergenic
1150462917 17:65367625-65367647 CTATATGCCCATCAGCAGAAGGG + Intergenic
1151390160 17:73781505-73781527 CCACAAGGGCAGCTGCAGAGAGG - Intergenic
1151773123 17:76177813-76177835 CCATAAGACCAGCTGCAGAGAGG + Intronic
1152240270 17:79157282-79157304 CCACAGGGCCAGCTGCAGAGTGG - Intronic
1156327305 18:36085760-36085782 CAAGACGACCAGCTGCAGAGGGG + Intergenic
1156684388 18:39627219-39627241 CTAGATGTAAAGCTGCAGAGGGG + Intergenic
1157042866 18:44060937-44060959 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1158655918 18:59333648-59333670 CTATATGTGCAGCTACAAAGCGG - Intronic
1159795646 18:72840012-72840034 CTATAAGACAAGCTACAGAGAGG - Intronic
1160292859 18:77609654-77609676 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1162033637 19:7927756-7927778 GCCCATGGCCAGCTGCAGAGGGG + Exonic
1165022656 19:32936643-32936665 TGAGATGACCAGCTGCAGAGAGG + Intronic
925048209 2:790320-790342 CTGGATGACCTGCTGCAGAGAGG + Intergenic
925088946 2:1137611-1137633 CTGTCTGGTCAGCTGCAGGGTGG - Exonic
927533815 2:23836717-23836739 CAGGATGACCAGCTGCAGAGAGG - Intronic
928840511 2:35599353-35599375 CAGGATGACCAGCTGCAGAGAGG + Intergenic
929492482 2:42408445-42408467 CAGGATGACCAGCTGCAGAGAGG + Intronic
929919896 2:46164549-46164571 CAGTATGGCCAGCTGAGGAGTGG - Intronic
931163208 2:59717106-59717128 CAATATAGCCAGGGGCAGAGTGG + Intergenic
934699901 2:96430789-96430811 CAGTATGACCAGCTGCAGAGAGG + Intergenic
935869617 2:107431959-107431981 ATATTTTGCCAGCTGCAGACCGG - Intergenic
937543757 2:122989660-122989682 CAGGATGACCAGCTGCAGAGGGG + Intergenic
939551373 2:143619781-143619803 TCACATGGCCAGCAGCAGAGAGG - Intronic
940396253 2:153195987-153196009 CAGGATAGCCAGCTGCAGAGAGG - Intergenic
940879821 2:158935475-158935497 CAACATGGGCAGCTACAGAGGGG - Intergenic
942104030 2:172614451-172614473 CGGGATGACCAGCTGCAGAGAGG + Intergenic
944318035 2:198304487-198304509 CTAAACAGACAGCTGCAGAGAGG - Intronic
945770373 2:214035137-214035159 TGATAAGACCAGCTGCAGAGAGG - Intronic
946197404 2:218043323-218043345 CTGGATGACCAGCTGCAGAGAGG - Intronic
948551607 2:238776337-238776359 CTCTCTGGGCGGCTGCAGAGAGG - Intergenic
948713038 2:239837005-239837027 ATGGATGACCAGCTGCAGAGAGG + Intergenic
1171055758 20:21904645-21904667 CTTGAAGGACAGCTGCAGAGTGG + Intergenic
1171236875 20:23534690-23534712 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1171242316 20:23581838-23581860 CTGATTGGCCATCTGCAGAGAGG + Intergenic
1174588663 20:51627846-51627868 CTATAGGGGAAGTTGCAGAGAGG + Intronic
1175065128 20:56277638-56277660 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1176000025 20:62827502-62827524 CTCTGTGGCCCCCTGCAGAGCGG + Intronic
1183494131 22:38132831-38132853 CGACATGGCCAGGTGCAGCGGGG + Exonic
1184124817 22:42479652-42479674 CTCTATGGCCAGCCTCAGGGCGG - Intergenic
1184173893 22:42775139-42775161 CTGGATGACCAGCTGCAGAGAGG + Intergenic
1184469582 22:44688698-44688720 ATATATGGCCAGGTGCAGTGTGG + Intronic
1184826666 22:46957183-46957205 CTGTATGCCCAGGTGAAGAGGGG - Intronic
1184865801 22:47201383-47201405 CAAGACGACCAGCTGCAGAGAGG - Intergenic
1185204657 22:49530905-49530927 CTCTGTGCCCAGATGCAGAGTGG - Intronic
950207626 3:11092694-11092716 CAGTACAGCCAGCTGCAGAGAGG + Intergenic
951369118 3:21823049-21823071 CTATTTGTTAAGCTGCAGAGTGG + Intronic
951593986 3:24297360-24297382 CTCTCTGGCGAGCTGCAGAAAGG + Exonic
953221657 3:40977323-40977345 CTAAATGGGCAACTGCTGAGAGG - Intergenic
954099353 3:48357651-48357673 CAGGATGACCAGCTGCAGAGAGG - Intergenic
954277778 3:49553963-49553985 CTTTAAGGCCAGCTGGGGAGTGG - Intergenic
954520616 3:51222326-51222348 CAATAGGGACAGCTGAAGAGTGG + Intronic
954871340 3:53769590-53769612 CTAGGAGGCCTGCTGCAGAGCGG + Intronic
960070486 3:113424587-113424609 ATATATGTCCATCTGCAGAGAGG + Intronic
960634213 3:119767972-119767994 CTGAATGACCAGTTGCAGAGAGG - Intergenic
961942942 3:130656443-130656465 CCAGTTGACCAGCTGCAGAGAGG - Intronic
962824518 3:139088410-139088432 CAGGATGACCAGCTGCAGAGAGG - Intronic
966256159 3:177918255-177918277 CAGGATGACCAGCTGCAGAGAGG + Intergenic
967653033 3:192009752-192009774 CTAGATAGCTAGCTGTAGAGAGG + Intergenic
969194216 4:5547606-5547628 CAGGATGACCAGCTGCAGAGAGG + Intronic
970105282 4:12575553-12575575 GTCTCAGGCCAGCTGCAGAGAGG + Intergenic
974633751 4:64530989-64531011 CGATATAGCTAGATGCAGAGTGG + Intergenic
974972983 4:68853963-68853985 CAATATGACCAGCTGCAGAGAGG - Intergenic
975254329 4:72216111-72216133 CAAGATGACCAGCTGCAGGGAGG - Intergenic
975910299 4:79258876-79258898 CTGGATGACCAGCTGCAGAAAGG + Intronic
975910307 4:79258944-79258966 CAGGATGACCAGCTGCAGAGAGG + Intronic
977359125 4:95981316-95981338 ATGGATGACCAGCTGCAGAGAGG + Intergenic
977487298 4:97665462-97665484 CAGGATGACCAGCTGCAGAGGGG - Intronic
978219705 4:106256030-106256052 ATGGATGGCCAGCTGTAGAGAGG - Intronic
978301030 4:107269987-107270009 ACACACGGCCAGCTGCAGAGAGG - Intronic
980442340 4:132865725-132865747 CTATATGTCCAGCTTTAGTGTGG - Intergenic
980450246 4:132959919-132959941 TGAGATGGCCAGCTGCAGGGAGG + Intergenic
982158026 4:152540422-152540444 ATGGATGACCAGCTGCAGAGAGG - Intergenic
983784597 4:171715696-171715718 CGAGATGACCAGCTGCAGAGAGG + Intergenic
985799586 5:1995795-1995817 CTAGACCCCCAGCTGCAGAGAGG + Intergenic
986145217 5:5071523-5071545 CCATAGGGCCACCTGCTGAGAGG + Intergenic
987136388 5:14903326-14903348 AAATCGGGCCAGCTGCAGAGAGG - Intergenic
987467974 5:18295348-18295370 CCATGTGACCAGCTGCAGAGAGG - Intergenic
988520283 5:31939449-31939471 CTGTGTGGCCAGATGCAGTGAGG + Intronic
989279149 5:39621717-39621739 TGGGATGGCCAGCTGCAGAGAGG - Intergenic
989833328 5:45949301-45949323 CTAAATGTCCAGCCGCAGAATGG - Intergenic
991107591 5:62861875-62861897 CAGGATGACCAGCTGCAGAGAGG - Intergenic
992021899 5:72633112-72633134 ATATCTGGTCAGCGGCAGAGCGG + Intergenic
992936805 5:81715767-81715789 ATAGATGGCCAGGTGCAGTGTGG + Intronic
994648305 5:102497463-102497485 CCAGATAGCCAGCTGCAGAGAGG - Intronic
998214953 5:140230623-140230645 CAATATGGCCAGCTGGAGTTTGG - Intronic
998498906 5:142614869-142614891 CTATGTGGAAAGCTGCAGAATGG - Intronic
999410246 5:151344129-151344151 CTTTATGGTCAGTTGCAGAAGGG - Intronic
999714834 5:154352322-154352344 CTTTATGTCCACTTGCAGAGGGG - Intronic
1002689074 5:181037709-181037731 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1004520875 6:16359432-16359454 CTGGATGACCAGTTGCAGAGAGG + Intronic
1005095999 6:22116962-22116984 AGATATGCCCAGCTGCATAGTGG + Intergenic
1006347990 6:33498415-33498437 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1006467079 6:34202378-34202400 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1006500968 6:34458490-34458512 CTCGATGACCAGCTGCAGAGAGG + Intergenic
1007242078 6:40433387-40433409 CTCTATGGTCAGCTCCAAAGAGG + Intronic
1009027352 6:58015995-58016017 TTTTATGGCCTGCTTCAGAGAGG - Intergenic
1009202891 6:60767479-60767501 TTTTATGGCCTGCTTCAGAGAGG - Intergenic
1009846871 6:69145775-69145797 CAGGATGACCAGCTGCAGAGAGG - Intronic
1012231141 6:96762449-96762471 CCAGATGACAAGCTGCAGAGAGG - Intergenic
1012418179 6:99032621-99032643 CTAGAAGGGCAGCTGCTGAGTGG - Intergenic
1014609361 6:123522083-123522105 GCATATGGTCAGCTTCAGAGTGG - Intronic
1018467780 6:164067127-164067149 TTATGTATCCAGCTGCAGAGAGG - Intergenic
1018899682 6:168044726-168044748 CGAGATGGGCGGCTGCAGAGAGG - Intronic
1020122636 7:5513656-5513678 CGACATGGCCAGCTCCGGAGAGG - Exonic
1022002594 7:26240289-26240311 CTTCATAGTCAGCTGCAGAGTGG + Intergenic
1025529449 7:61860025-61860047 CCATATGGCCATCTGCAGAATGG + Intergenic
1025531197 7:61886459-61886481 CTAAATGGCCATTTGCAGAATGG + Intergenic
1028640807 7:93039994-93040016 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1030514027 7:110519198-110519220 TCAGATGACCAGCTGCAGAGAGG - Intergenic
1031243316 7:119273006-119273028 CAAATTGACCAGCTGCAGAGTGG - Intergenic
1031836486 7:126686043-126686065 CCAGATGACAAGCTGCAGAGAGG + Intronic
1032487370 7:132297998-132298020 TTAGGAGGCCAGCTGCAGAGAGG - Intronic
1033291938 7:140092864-140092886 CTTTATGACCAGCTACAGTGAGG + Intronic
1033929874 7:146508184-146508206 CCATATGGCCACCTGGAAAGTGG + Intronic
1037777863 8:21847650-21847672 CTGGAGGACCAGCTGCAGAGAGG - Intergenic
1038729299 8:30112982-30113004 CTTTTTGGCCAGGTGCAGAGTGG + Intronic
1040101988 8:43513670-43513692 CTTTATGTCCAGATGCAGAAAGG + Intergenic
1040725612 8:50378780-50378802 CAGGATGACCAGCTGCAGAGAGG - Intronic
1042004949 8:64169589-64169611 CAAGACGACCAGCTGCAGAGAGG + Intergenic
1043929265 8:86071646-86071668 CTGTGCGGCCAGCTGCAGACAGG - Intronic
1044361878 8:91295249-91295271 CTTTATGCCAATCTGCAGAGAGG + Intronic
1049606816 8:143533376-143533398 GCACAGGGCCAGCTGCAGAGAGG - Intronic
1049695746 8:143983606-143983628 GTGGAGGGCCAGCTGCAGAGCGG + Exonic
1049824044 8:144655471-144655493 TGGGATGGCCAGCTGCAGAGAGG + Intergenic
1050182366 9:2934605-2934627 CTGGATGAACAGCTGCAGAGAGG + Intergenic
1050920074 9:11189123-11189145 CTAGATGGCAAGAAGCAGAGAGG - Intergenic
1051111258 9:13639548-13639570 CTATATGGCCTGCTGCCTAGTGG - Intergenic
1051575520 9:18611122-18611144 CTGTATGCCCAGCAGCAGAAGGG + Intronic
1052633528 9:31071519-31071541 CAGGATGACCAGCTGCAGAGAGG - Intergenic
1057468594 9:95337962-95337984 CAGGATGACCAGCTGCAGAGAGG + Intergenic
1057702209 9:97371526-97371548 CTCCAAGGCCAGCTGAAGAGGGG - Intronic
1057818254 9:98311606-98311628 CTATATCTCCAGTTGCACAGAGG - Intronic
1059566359 9:115386073-115386095 GGAGATGACCAGCTGCAGAGAGG + Intronic
1060202203 9:121657820-121657842 CTATTTGCCCAGCTGCTGAATGG + Intronic
1061266416 9:129507873-129507895 CTCTTTGGCCAGCAGCAGAGGGG - Intergenic
1061267387 9:129514644-129514666 CAGGAAGGCCAGCTGCAGAGAGG + Intergenic
1062206554 9:135340886-135340908 CCATCTGGTCAGCAGCAGAGCGG - Intergenic
1188612984 X:32122112-32122134 CTATAGGCCAAGCTGCAGAAGGG + Intronic
1189863317 X:45295843-45295865 TTATAGGGTCAGCTGGAGAGAGG + Intergenic
1190364951 X:49683806-49683828 CTATATAGCCATCTGCAAACAGG + Intergenic
1193108437 X:77704307-77704329 CAGGATGACCAGCTGCAGAGAGG - Intronic
1193468717 X:81875277-81875299 CCAGATGACCAGCTGCAGAGAGG - Intergenic
1197378435 X:125710048-125710070 CAAGATGACCAGCTACAGAGAGG + Intergenic
1197609520 X:128623091-128623113 CTGGGTGGCCAGCTGCAGAGAGG - Intergenic
1197744555 X:129922952-129922974 CTAGATGGCCAGTTGTTGAGGGG - Intronic
1201935381 Y:19406314-19406336 CCACATGACCAGCTGCAGAGAGG - Intergenic
1202378890 Y:24259889-24259911 CTCTCTGGCCTGCTCCAGAGTGG + Intergenic
1202491892 Y:25410232-25410254 CTCTCTGGCCTGCTCCAGAGTGG - Intergenic