ID: 1119434801

View in Genome Browser
Species Human (GRCh38)
Location 14:74591282-74591304
Sequence GGGTTAGGGCTGGCAAACTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 117
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 106}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119434788_1119434801 27 Left 1119434788 14:74591232-74591254 CCCACATTCCTAGAAACCATTTT 0: 1
1: 0
2: 0
3: 21
4: 284
Right 1119434801 14:74591282-74591304 GGGTTAGGGCTGGCAAACTTTGG 0: 1
1: 0
2: 1
3: 9
4: 106
1119434795_1119434801 4 Left 1119434795 14:74591255-74591277 CCAAGCAGGGAATTAGGTCTTCA 0: 1
1: 0
2: 0
3: 18
4: 131
Right 1119434801 14:74591282-74591304 GGGTTAGGGCTGGCAAACTTTGG 0: 1
1: 0
2: 1
3: 9
4: 106
1119434790_1119434801 19 Left 1119434790 14:74591240-74591262 CCTAGAAACCATTTTCCAAGCAG 0: 1
1: 1
2: 4
3: 40
4: 252
Right 1119434801 14:74591282-74591304 GGGTTAGGGCTGGCAAACTTTGG 0: 1
1: 0
2: 1
3: 9
4: 106
1119434793_1119434801 11 Left 1119434793 14:74591248-74591270 CCATTTTCCAAGCAGGGAATTAG 0: 1
1: 0
2: 2
3: 10
4: 261
Right 1119434801 14:74591282-74591304 GGGTTAGGGCTGGCAAACTTTGG 0: 1
1: 0
2: 1
3: 9
4: 106
1119434789_1119434801 26 Left 1119434789 14:74591233-74591255 CCACATTCCTAGAAACCATTTTC 0: 1
1: 0
2: 2
3: 38
4: 345
Right 1119434801 14:74591282-74591304 GGGTTAGGGCTGGCAAACTTTGG 0: 1
1: 0
2: 1
3: 9
4: 106

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119434801 Original CRISPR GGGTTAGGGCTGGCAAACTT TGG Intronic
900976241 1:6018388-6018410 GGATTAGGGCTATCAATCTTGGG - Intronic
911444689 1:97976990-97977012 GGGTCAGGGCTGGCAAAATGTGG - Intergenic
915973084 1:160367516-160367538 GGGTTAGGGCTGGCAGAAGTGGG + Intronic
916796282 1:168170542-168170564 GGGATAGGGCTGGCAGACAAAGG - Intergenic
918233916 1:182560519-182560541 GGGTGAGGGCTGGCACCCTGAGG - Exonic
918445156 1:184610085-184610107 GGGGCAGGGCAGGCAAACTATGG + Intronic
921576179 1:216837535-216837557 GATTTAGGACTGGCAAATTTTGG + Intronic
922060113 1:222080975-222080997 TGGTGAGTGCTGGCAATCTTTGG + Intergenic
922846505 1:228689208-228689230 GGGTTGGGTCTGACAAACTCAGG - Intergenic
1070158649 10:73852080-73852102 GGGCTAGGGCTTGCATACTGTGG - Intronic
1071786086 10:88901590-88901612 GGGTTTGGGATTTCAAACTTGGG + Intronic
1073267125 10:102234489-102234511 GGTTTGGAGCTGGAAAACTTTGG + Intronic
1074472246 10:113738001-113738023 AGGCTAGGGCTGCCAAACTTAGG - Intergenic
1087134302 11:94699981-94700003 TGGTTATGGCTGGCAATCCTTGG - Intergenic
1090930884 11:131297264-131297286 TGGGTAGGGCTGGGAAACGTGGG - Intergenic
1091276897 11:134358829-134358851 GGGGCAGGGCTGGCAAACTAGGG - Intronic
1093323286 12:17740768-17740790 AGATTTGAGCTGGCAAACTTAGG + Intergenic
1101958971 12:109233898-109233920 GGGGTAGGGCTGGAAAGCCTGGG - Intronic
1102510214 12:113410120-113410142 GGATGAGGGGTGGCAAACCTAGG + Intronic
1103020582 12:117530888-117530910 GGGCCAGGGCTGGGAAGCTTGGG + Intronic
1103105486 12:118220979-118221001 GAGCAAGGGCTGGCAAACTATGG + Intronic
1107288569 13:38824923-38824945 GGGTTTAGGCTGGTTAACTTTGG - Intronic
1109777981 13:67067895-67067917 GGTAAAGGTCTGGCAAACTTAGG + Intronic
1114332093 14:21647223-21647245 GGATTAGGGCAGGGAATCTTGGG + Intergenic
1114690046 14:24573197-24573219 GGATTAGGTCTGGGAAACATAGG - Intergenic
1116794390 14:49374190-49374212 GGGTTGGGGCTGCCACAGTTAGG + Intergenic
1119434801 14:74591282-74591304 GGGTTAGGGCTGGCAAACTTTGG + Intronic
1120970688 14:90204595-90204617 GGGTTAGGGCTGGCACACCTGGG + Intergenic
1121692872 14:95890366-95890388 GGGTTGGGGCTGCCATACTGGGG - Intergenic
1122222256 14:100247207-100247229 GTTTTAAGGCTGGGAAACTTAGG + Intronic
1126077482 15:44925934-44925956 GGGTTAGAGCTGAGAAAATTTGG + Intergenic
1126081233 15:44964588-44964610 GGGTTAGAGCTGAGAAAATTTGG - Intronic
1126336623 15:47592073-47592095 AGATTAGGGCTGGAAAACTCAGG - Intronic
1127146908 15:56034322-56034344 AGGGTAGGGTTGGCAAATTTAGG - Intergenic
1127198039 15:56611701-56611723 GAGTGAGGGCTGGGAAACTGAGG + Intergenic
1132310335 15:100852916-100852938 GGGTTGGGGATGGCATACGTGGG - Intergenic
1137269713 16:46895141-46895163 GGCTTAGGGGTGGCACACTAGGG + Intronic
1139264875 16:65629259-65629281 GGGTTGGGGCTGGAAGACCTAGG - Intergenic
1141935098 16:87233208-87233230 GGCATAGTGCTGGCAACCTTAGG - Intronic
1142703727 17:1680854-1680876 GGGCCAGGGCGGGAAAACTTTGG - Intronic
1143792547 17:9309072-9309094 GGGTAAGGGGTGGCAAATTAGGG + Intronic
1144339867 17:14302181-14302203 GGGGTAGGGCAGGGAAACTACGG + Intronic
1145821182 17:27836945-27836967 GGTTTAGGCCTAGCTAACTTTGG + Intronic
1146729832 17:35183776-35183798 GGGTTTGAGCTAGCACACTTGGG - Intronic
1153225686 18:2898134-2898156 GGGGTAAGGCTGGGCAACTTGGG - Intronic
1153576983 18:6532246-6532268 GGGAAAGGGCAGGCAAACTGGGG - Intronic
1153585723 18:6617971-6617993 GGGGTAGGGGTGACAAACTATGG + Intergenic
1158731223 18:60024935-60024957 GGGTTAGGGGTGCCAACCTATGG - Intergenic
1159083093 18:63757507-63757529 GGGTAGGGGTTGGCAAACTCTGG + Intronic
1164603405 19:29578768-29578790 GGGTTGGGGCTGGCAGTCCTAGG - Intergenic
1165421293 19:35723234-35723256 GTGTTAGGGCCCCCAAACTTGGG - Exonic
1166566641 19:43769618-43769640 GGGCTAGGGCTGGGACTCTTGGG + Intronic
925484789 2:4316252-4316274 GGCTTGGAGCTGGCAGACTTGGG - Intergenic
926922851 2:17956592-17956614 GGGGTAGGGCTGGCCAACACTGG + Intronic
932818603 2:74881003-74881025 GAGTCAGGGTTGGCAAACTATGG + Intronic
940049636 2:149448552-149448574 GGGTTAGGGATGGCAGAGGTGGG - Intronic
940869398 2:158847562-158847584 GGGTGGGGACTGGGAAACTTTGG + Intronic
941300468 2:163794893-163794915 GAGTAAGGGCTGGCAAACAAGGG + Intergenic
946194068 2:218022788-218022810 GGGTTAGGGGTGGCAGAGATGGG + Intergenic
946333396 2:219022722-219022744 GGGTTGGGGAGGCCAAACTTGGG - Intronic
946733107 2:222728128-222728150 GGGTCAGGGCTGGCACACCATGG - Intergenic
947861851 2:233366101-233366123 TGGTTAGGGCTGGTAAGCATCGG + Intronic
1170101489 20:12705334-12705356 TGAGTAGGGATGGCAAACTTGGG - Intergenic
1173039281 20:39445906-39445928 GGGTAAGAGTTGGCAAGCTTCGG + Intergenic
1173225455 20:41159983-41160005 GGGTTAGGGCTGGGAGCATTAGG + Intronic
1173729372 20:45317854-45317876 GGGTTGGGGGAGGCACACTTGGG - Intergenic
1181268303 22:21643620-21643642 GGGTTAGGACTGGGAAAATGTGG + Intronic
1182748776 22:32625460-32625482 GGGCTGGGGATGGCAAACTTGGG - Intronic
1182874874 22:33682906-33682928 GGGTTGGAGCCAGCAAACTTGGG - Intronic
1184355479 22:43976851-43976873 GGGTGAGGGGAGCCAAACTTTGG + Intronic
1184416780 22:44356591-44356613 GGGGTTTGGCTGGCAATCTTTGG - Intergenic
949294969 3:2510905-2510927 GGGTTTGGCATGGCACACTTGGG - Intronic
950530089 3:13548320-13548342 GGGTGGGGGCAGGCACACTTTGG + Intergenic
950575686 3:13830769-13830791 GCCTTAGGGCTGGCAACATTGGG - Intronic
962067938 3:132002832-132002854 GGGATAGGCTTGGCAAAGTTTGG - Intronic
969207285 4:5656407-5656429 GAATTAGGGCTGGAAATCTTTGG - Intronic
970257501 4:14183956-14183978 GGGTTATGGCTGCCAAATTTAGG - Intergenic
971407844 4:26338851-26338873 GTGTGAGGCCTGGCAAAGTTGGG + Intronic
971633630 4:29028786-29028808 GGGTTAGGGCAGCAAAACATAGG + Intergenic
975696730 4:77021319-77021341 GGGATAGGGCTGGCAAGGCTGGG + Intronic
978619081 4:110621799-110621821 GGGAAAGGGCCGGCGAACTTCGG - Intronic
982224985 4:153156877-153156899 GGGTTAGGGCTGTTGTACTTTGG + Intronic
982779965 4:159480426-159480448 GGGGCAGTGCTGGTAAACTTGGG + Intergenic
983260554 4:165451886-165451908 GGCTTAGGGGAGACAAACTTGGG - Intronic
989069397 5:37494894-37494916 GTGTTAGGGTTGGCAAACCATGG + Intronic
991246950 5:64518744-64518766 GTGGTAGGGATGGCAAACATTGG + Intronic
992484967 5:77185866-77185888 GGGTTAGAGATGGGAAACCTAGG + Intergenic
999428827 5:151508980-151509002 GTTTTAGGGCTCCCAAACTTGGG - Intronic
1003932244 6:10935943-10935965 GGTTAAGGGTTGGCAAACTCTGG - Intronic
1010341671 6:74760500-74760522 GGGTTAGAGCAGACATACTTTGG + Intergenic
1014547678 6:122752056-122752078 GGGTTAGGGGTGGAAAGCTGGGG - Intergenic
1017061222 6:150486952-150486974 GGGTGAGGGCTGGGGAAATTAGG - Intergenic
1018740275 6:166723153-166723175 GGGCTGGGGCTGGCAGGCTTGGG + Intronic
1026869881 7:73843923-73843945 GGGTTTGGGCAGGCAGAATTTGG + Intergenic
1028585195 7:92445636-92445658 GGGCTAAGGCTGGCAAATTGTGG + Intergenic
1030093545 7:105877509-105877531 GGGTTTGCGCAGGCAACCTTTGG + Intronic
1030487940 7:110194461-110194483 AGGTTGGTGCTGGCAGACTTCGG + Intergenic
1031496899 7:122460905-122460927 GAGTAAGGGTTGGCAAACTACGG + Intronic
1039009572 8:33077997-33078019 GGACTAGGGCTGGGAAACCTGGG + Intergenic
1039033634 8:33335581-33335603 GGGTTAGGGGTGCCAAACCTGGG + Intergenic
1039928953 8:41965398-41965420 GTGTTAGGGTTGGCAAAATATGG - Intronic
1044209286 8:89531881-89531903 GGATTAGGGCAGGAAATCTTCGG - Intergenic
1045322911 8:101095424-101095446 GGGTGAGGGCTGGCAAGCTGAGG + Intergenic
1047601325 8:126428813-126428835 GGGTTAAGGCTGGATATCTTAGG + Intergenic
1049322105 8:142002058-142002080 GGCTTAGGTCTGGGAAACCTGGG - Intergenic
1050899102 9:10922511-10922533 GGGTTAGAGGTGTCAAACTAGGG + Intergenic
1055057302 9:72035693-72035715 AGGTTAGGGCTGATAATCTTAGG + Intergenic
1056340543 9:85626977-85626999 AGGTTAGGGTTGGCATACTGCGG - Intronic
1059961919 9:119573989-119574011 AGGTTAGGGCTGGGAAAGCTGGG - Intergenic
1061555562 9:131366301-131366323 GGCTTAGGCCAGGCTAACTTTGG - Intergenic
1186776546 X:12870591-12870613 GGGCTGGGGTTGGCAAACTATGG + Intronic
1186923236 X:14304626-14304648 GAGTGAGGGTTGGCAAACTATGG - Intergenic
1187093831 X:16125849-16125871 GATTCAGGGCTGGCAAACTCTGG + Intronic
1187168474 X:16827435-16827457 GGGTTAAGGCTGGAATACTTGGG + Intronic
1189204331 X:39224979-39225001 GGGATATTGCTGGAAAACTTTGG - Intergenic
1189752339 X:44235072-44235094 GGCTTAGGGCTGGGAGACCTGGG - Intronic
1194662666 X:96644027-96644049 GGGTAAGGGATGGTATACTTTGG - Intergenic