ID: 1119436265

View in Genome Browser
Species Human (GRCh38)
Location 14:74599811-74599833
Sequence TGCCCATGCTCAGGGAGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 263
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119436265_1119436277 30 Left 1119436265 14:74599811-74599833 CCAGCACTCCCTGAGCATGGGCA 0: 1
1: 0
2: 0
3: 8
4: 254
Right 1119436277 14:74599864-74599886 ACTGAGTCTCCCTGTGGTTCTGG 0: 1
1: 0
2: 0
3: 29
4: 429
1119436265_1119436273 3 Left 1119436265 14:74599811-74599833 CCAGCACTCCCTGAGCATGGGCA 0: 1
1: 0
2: 0
3: 8
4: 254
Right 1119436273 14:74599837-74599859 GGTTGGGCCCACAGATATCTGGG 0: 1
1: 0
2: 1
3: 7
4: 100
1119436265_1119436272 2 Left 1119436265 14:74599811-74599833 CCAGCACTCCCTGAGCATGGGCA 0: 1
1: 0
2: 0
3: 8
4: 254
Right 1119436272 14:74599836-74599858 GGGTTGGGCCCACAGATATCTGG 0: 1
1: 0
2: 0
3: 3
4: 96
1119436265_1119436276 24 Left 1119436265 14:74599811-74599833 CCAGCACTCCCTGAGCATGGGCA 0: 1
1: 0
2: 0
3: 8
4: 254
Right 1119436276 14:74599858-74599880 GGAGAGACTGAGTCTCCCTGTGG 0: 1
1: 0
2: 6
3: 47
4: 450

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119436265 Original CRISPR TGCCCATGCTCAGGGAGTGC TGG (reversed) Intronic
900254607 1:1691561-1691583 TGCCCCTGGTCAGGAAGTCCAGG + Intronic
900263359 1:1744836-1744858 TGCCCCTGGTCAGGAAGTCCAGG + Intronic
900362879 1:2298442-2298464 TGCCCATGCTCAGGATGGTCTGG + Intronic
900624829 1:3603351-3603373 AGCCCCTGCTCTGGGGGTGCTGG - Intronic
900655834 1:3756496-3756518 AGCGCGTGCTGAGGGAGTGCAGG - Intronic
900657102 1:3763859-3763881 GGCCCATGCTCATGGAGCGGAGG - Intronic
900702999 1:4059454-4059476 TGTCCATGCTCAGGGAGCCTGGG + Intergenic
901261632 1:7875803-7875825 TCCCCAGGCTCAGGGACTGGTGG - Intergenic
902541148 1:17155860-17155882 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
902837194 1:19054693-19054715 TGCCCATGAGGAGGGACTGCTGG + Intergenic
902962010 1:19970462-19970484 TGCCCCATCTCAGGGAGGGCCGG + Intergenic
904141760 1:28358970-28358992 TGCCCACGGTCAGGAAGTGGTGG + Intergenic
904277624 1:29394733-29394755 TCCCCATGCTCAGGGATGGGGGG - Intergenic
905925168 1:41744463-41744485 TGGCCATGATCAGGGTGTGCTGG + Intronic
907246193 1:53110567-53110589 TGCCCTTACTCAGGGGCTGCGGG - Intronic
910631099 1:89355122-89355144 GGGCCATGATCAAGGAGTGCAGG - Intergenic
910636091 1:89409629-89409651 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
912046961 1:105470882-105470904 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
912711085 1:111950433-111950455 TGCCGGTCCTCAGGGAGTGAGGG - Intronic
913227299 1:116711426-116711448 TGCCCATCCACAGTGAGGGCGGG - Intergenic
915503621 1:156338143-156338165 TGCTCGTGCTCAGTGAGTTCTGG - Exonic
915662345 1:157414826-157414848 TGCCCAAGCTCAGGTAGCACTGG + Intergenic
915752738 1:158227358-158227380 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
915828858 1:159106203-159106225 CAGCCATGCCCAGGGAGTGCCGG + Intronic
916717387 1:167456701-167456723 TGCAAATGCTCAGGTAGGGCTGG - Intronic
919060030 1:192620720-192620742 TCCCCAGGCTCATGGACTGCTGG + Intergenic
919748541 1:201023222-201023244 GGCCCCTCCTCCGGGAGTGCAGG + Intronic
920031493 1:203040057-203040079 GGCGCATGCTCTGGGAATGCAGG + Intronic
920776567 1:208943817-208943839 AGCCCATTCTCAGGGACAGCAGG + Intergenic
921617065 1:217281485-217281507 TGCCCAATCTCAGGTAGGGCTGG + Intergenic
924282011 1:242447848-242447870 TGCCCATGCTCAAAGTATGCTGG + Intronic
924611384 1:245576574-245576596 TGGCCAGGCACACGGAGTGCAGG - Intronic
1063328312 10:5127682-5127704 TGCCCAGGCTGCTGGAGTGCAGG - Intronic
1070378115 10:75854118-75854140 TGGACATGCTGTGGGAGTGCAGG + Intronic
1070728303 10:78807558-78807580 GGCCCATGCTCAGTGACTGTGGG + Intergenic
1070781935 10:79142711-79142733 TGGCCAGGGTCAGGGAGTGCCGG - Intronic
1072249826 10:93572693-93572715 TGCCCTGATTCAGGGAGTGCAGG + Intronic
1074457135 10:113604821-113604843 GGCCCATGCGCCGGCAGTGCTGG + Exonic
1074495801 10:113979123-113979145 TGCCCTTGTTCAGGGTGAGCCGG - Intergenic
1074496545 10:113984554-113984576 TGCCCATGCTCATAGACAGCTGG + Intergenic
1075352519 10:121736524-121736546 CGGCCATGCACAGGGAGAGCTGG + Intergenic
1076841255 10:133046920-133046942 TGCCCAGGCTAACGGAATGCAGG + Intergenic
1077034515 11:488281-488303 TGCCCAACTTCAGCGAGTGCTGG + Exonic
1077219514 11:1409480-1409502 CTCCCCTGCTCAGGGTGTGCCGG + Intronic
1081037981 11:38174082-38174104 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1082006939 11:47424639-47424661 TGCCCTTCCTCTGGGAGTCCAGG + Exonic
1082010660 11:47447952-47447974 TGCCCATGCTCAGGCTGACCTGG + Exonic
1082238871 11:49851963-49851985 TCCCCAGGCACAGGGAGTTCTGG - Intergenic
1082972344 11:59036940-59036962 AGCCCATGCTTATGGTGTGCAGG - Intronic
1083300748 11:61738590-61738612 TCCCTAGGCTCAGGGAGGGCTGG + Intronic
1084524230 11:69685983-69686005 GGCCGAGGGTCAGGGAGTGCAGG - Intergenic
1088840587 11:113624386-113624408 TTTCCATACTCAGTGAGTGCAGG - Intergenic
1089009304 11:115119643-115119665 TGCCCATGCTCATGATGTGGGGG + Intergenic
1089346528 11:117795165-117795187 AGCCCATTCCCGGGGAGTGCAGG - Intronic
1089738783 11:120567637-120567659 TTCCCCTGCTCAGCAAGTGCTGG - Intronic
1089752281 11:120660381-120660403 TACCGATCCTCAAGGAGTGCGGG - Exonic
1090351898 11:126113248-126113270 TGCCCTTGCTTCGGGAGTGGAGG - Intergenic
1091023246 11:132119796-132119818 TGGCAATGCACAGGCAGTGCTGG + Intronic
1091621751 12:2094292-2094314 ATCCCATGCTCAAGGAGTTCCGG + Intronic
1095554111 12:43480788-43480810 TCCACATGCTGAGGGAGTGTGGG + Intronic
1095855647 12:46857892-46857914 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1096769384 12:53924702-53924724 AGCCCAGGCTGAGAGAGTGCTGG + Intergenic
1097138298 12:56878361-56878383 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1098913332 12:76232359-76232381 AGCCCATGCTCACAGAGTGAAGG - Intergenic
1098987643 12:77029816-77029838 TGCCCAAGGTAAGGGAGTGCAGG - Exonic
1099467495 12:83005535-83005557 TCCCCATGCTCTGAGAGTGACGG + Intronic
1100853387 12:98736862-98736884 TGCAGATGCTCAAGGAGTACAGG - Intronic
1101942684 12:109111460-109111482 AGCCCAGGCTCAGGTAGTGGGGG + Intergenic
1101955549 12:109209115-109209137 TGCCCATGCCCATGCAGGGCTGG + Intronic
1102748288 12:115269226-115269248 TGGCCATGCTCAGGGAAACCTGG - Intergenic
1103039001 12:117679223-117679245 TGCTGATGCACATGGAGTGCTGG - Intronic
1106469783 13:30044106-30044128 TGCCCATGATCAAGGTCTGCAGG - Intergenic
1107914285 13:45133463-45133485 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1112342513 13:98564424-98564446 TCCCCATGCTCAGCCACTGCAGG - Intronic
1119436265 14:74599811-74599833 TGCCCATGCTCAGGGAGTGCTGG - Intronic
1120154837 14:81082107-81082129 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1122256258 14:100479268-100479290 TCCCCCTGCTCAGGGAGCACAGG - Intronic
1122369265 14:101220018-101220040 TGCCCATGCTCACGAAGGGCTGG - Intergenic
1123220007 14:106845812-106845834 TCCTTATGCTGAGGGAGTGCTGG + Intergenic
1123984236 15:25630876-25630898 TGCCCAGCTCCAGGGAGTGCTGG + Intergenic
1125933570 15:43616590-43616612 CGCCCGTGCTCAGGCAGTGAAGG + Exonic
1125946668 15:43716052-43716074 CGCCCGTGCTCAGGCAGTGAAGG + Intergenic
1126751149 15:51877846-51877868 TGCCCATGTTCATGCAGAGCTGG - Intronic
1128248738 15:66150527-66150549 TGCCCATGGACAGGGAGGGTGGG - Intronic
1129276839 15:74451139-74451161 TTCCCTTACTCAGGGTGTGCAGG + Intronic
1129673531 15:77620350-77620372 TTCCCAGGCTCAGGCAGTGGGGG + Intronic
1129983700 15:79897264-79897286 GGCCCAGGCTCAGGGAGGTCAGG - Intronic
1131054864 15:89369144-89369166 TGCCCCTGCTCAGTGCGTGGGGG + Intergenic
1131827635 15:96333404-96333426 TGCCCAGGCTCCGCTAGTGCCGG + Intronic
1132123262 15:99196649-99196671 AGCCCATACTCAGGTGGTGCTGG - Intronic
1132807255 16:1780541-1780563 TGCACTTGCTCAGGGAGGCCAGG - Intronic
1133215958 16:4292657-4292679 TGCCCCTCCCCAGGGAGAGCTGG - Intergenic
1133308957 16:4830435-4830457 TGGCCATGGTCAGGGAGTCTGGG - Intronic
1137406115 16:48190796-48190818 TGACCATGCTCAGCCAGTGGAGG + Intronic
1138506459 16:57480587-57480609 TGCCCATGCTCAGGACATGGAGG - Intronic
1138525022 16:57600245-57600267 TGCCTGTGCTCAGGGAAGGCAGG - Intergenic
1140095211 16:71869339-71869361 TGCCCAAGGTCTAGGAGTGCAGG - Intronic
1140775967 16:78249200-78249222 TTCCCAAGCTCATGGAGTGGTGG + Intronic
1140881653 16:79203967-79203989 TGCCCGTGCTAAAGGACTGCTGG - Intronic
1141518391 16:84561598-84561620 AGCACCTGCTGAGGGAGTGCTGG + Intergenic
1143003095 17:3808050-3808072 TGTCTATGCTCATGGAGTGAAGG - Intergenic
1145355408 17:22142009-22142031 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1145361109 17:22213165-22213187 TCCCAATGTTGAGGGAGTGCTGG - Intergenic
1151399886 17:73849108-73849130 AGGACATGCTCAGGGGGTGCTGG - Intergenic
1151477917 17:74354286-74354308 CGCCCTCGCTCAGTGAGTGCAGG - Exonic
1152050810 17:77974859-77974881 TGCCCAAGATCAGGTAGTCCTGG + Intergenic
1152615475 17:81335980-81336002 TGGGCATGCTCAAGGAGGGCGGG - Intergenic
1153777444 18:8466439-8466461 GGCCCATGCCCAGGGAGTGTGGG - Intergenic
1154061378 18:11063729-11063751 TGCCCGGGAGCAGGGAGTGCAGG + Intronic
1157452880 18:47801301-47801323 TGGGCTTGCTCAGGGACTGCTGG - Intergenic
1157804276 18:50646513-50646535 TGTCTATGCTCAGGGGGTCCAGG - Intronic
1160531464 18:79567494-79567516 CGCCCCTGGTCAGGGGGTGCTGG + Intergenic
1160532442 18:79573458-79573480 TGCCCATGGACAGGGATGGCTGG - Intergenic
1160703223 19:518033-518055 GGCCCAGGCTGAGGGGGTGCTGG + Intronic
1160749445 19:727105-727127 GACCCAGGGTCAGGGAGTGCAGG + Intronic
1161104598 19:2437056-2437078 TGGCCAGGCCCAGGGAGTGGGGG - Intronic
1161238002 19:3207478-3207500 TGCCCAGGCTCAGGTGGGGCAGG + Intronic
1161266052 19:3365365-3365387 TGCCCATCCTGTGGGATTGCTGG - Intronic
1161683793 19:5693390-5693412 TGCCCATGGCCAGGGACAGCAGG + Exonic
1163362990 19:16859784-16859806 GACCCAGGCTCAGAGAGTGCTGG - Intronic
1163367201 19:16881885-16881907 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1163611339 19:18303462-18303484 TGGCCTTGCCCAGGAAGTGCAGG - Intergenic
1164404477 19:27931466-27931488 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1167220772 19:48196784-48196806 TGGACCTGCTCAGGGATTGCTGG + Intronic
925599620 2:5594915-5594937 TGCACATGCTAAGAGAGAGCGGG + Intergenic
926336146 2:11864268-11864290 TGTCCAGGCTCTGGGAGTGGAGG - Intergenic
926755031 2:16227499-16227521 TGCCCAGGCGCAGGAAGTGTGGG - Intergenic
929483596 2:42335981-42336003 TGCCCATGGTCAGAGAAGGCAGG - Intronic
930754032 2:54958032-54958054 TGCCCATGCCCAGGGGGTCTGGG - Intronic
934761670 2:96860081-96860103 TGCCCCTTCAGAGGGAGTGCAGG - Exonic
935332103 2:101984943-101984965 TGCCCTGGGTCAGGGAGTGAGGG - Intergenic
936572991 2:113631802-113631824 GGCACATGCTCAGAAAGTGCAGG - Intronic
936854213 2:116937162-116937184 TGCACATGCTTAGGGATAGCTGG - Intergenic
937892507 2:126949298-126949320 AGCCCCTGCTCAGGCAGTGATGG + Intergenic
938293757 2:130164052-130164074 TGCTCTTGCTCTGGGAGTGGGGG - Intronic
939564953 2:143775932-143775954 AGCCCATGCACAGGGGGTTCAGG - Intergenic
941003302 2:160222895-160222917 TGCCCATCCTTAGGTAGTGAGGG - Intronic
941641707 2:167995929-167995951 GGCCCAGGCTCAGAGGGTGCTGG + Intronic
942444384 2:176068367-176068389 TGGCCATGCCCAGAGAGTGCAGG - Intergenic
942447754 2:176089420-176089442 TGGCCAAGATCAGGAAGTGCAGG - Intergenic
943367432 2:186979663-186979685 TGCACAGGGTCAGGGACTGCAGG - Intergenic
946065781 2:216986052-216986074 AGCCCAAGCTCAGGGACTGTCGG + Intergenic
948091294 2:235298101-235298123 TGCCCTTTCCCAGGGAGAGCAGG - Intergenic
948723344 2:239917348-239917370 TCCCTATGTTGAGGGAGTGCTGG - Intronic
948746056 2:240095309-240095331 TGCCTGGGCTCTGGGAGTGCAGG - Intergenic
948864755 2:240769563-240769585 TGCCCAGGCTCCGGGCTTGCTGG + Intronic
1168796515 20:613326-613348 TGCCCATGGTCAGGGAGGCAGGG - Intergenic
1168831487 20:847465-847487 TCCCCATGCTGAAGGAGTGATGG + Intronic
1169184222 20:3599716-3599738 TGGGCATGCTCAGGGGGTCCTGG + Intronic
1169220341 20:3818901-3818923 TGCACTTTCTCAGGGGGTGCTGG + Intergenic
1172162769 20:32879944-32879966 TCCTCATGCTTAGGGAGTCCAGG - Intronic
1172808942 20:37633409-37633431 TGCCCATCAGCAGGGAGTGTGGG - Intergenic
1172939348 20:38643963-38643985 TGCCCAGGCTCCTGGAGAGCAGG - Intronic
1173545445 20:43894221-43894243 AGCCGTTGCTCAGGGAGTGGAGG + Intergenic
1175191513 20:57215103-57215125 TGCCCATGGCCTGGGAGTGTGGG - Intronic
1175245187 20:57577992-57578014 TCCCCATGCACAGGGAGTCCAGG + Intergenic
1175697156 20:61111175-61111197 AGCCGCTCCTCAGGGAGTGCTGG + Intergenic
1175872377 20:62214551-62214573 TGGCCATGCCCAGCGTGTGCAGG - Intergenic
1175923533 20:62461205-62461227 TGCCCAGGTCCAGGCAGTGCAGG + Intergenic
1178284678 21:31315636-31315658 TGCCCAGGCTGGAGGAGTGCAGG - Intronic
1179889088 21:44326829-44326851 TGTCCATGCTCAGGGTGCGGCGG - Exonic
1181078719 22:20400048-20400070 TGCCCAGGCCCAGGGGGAGCAGG + Intronic
1181635033 22:24170561-24170583 AGCCCATCCTGTGGGAGTGCGGG - Intronic
1182698127 22:32209924-32209946 TGCCCATGGTGAGGGGGTGAGGG - Intergenic
1182748562 22:32624227-32624249 TGCCAATGCCCAGGGAGGCCTGG + Intronic
1182849601 22:33460890-33460912 GGCCCATTCTCAGGGAGTTTGGG + Intronic
1183363177 22:37393558-37393580 GGTCCAGGCTCAGGAAGTGCTGG - Intronic
1184588795 22:45466943-45466965 TGAACATGCTCAAGGAATGCAGG - Intergenic
1184797489 22:46740514-46740536 TGCTCATGCTCAGGGAGACAGGG + Intergenic
1185427197 22:50779072-50779094 GGCACATGCTCAGAAAGTGCAGG + Intronic
949534236 3:4983460-4983482 TGCCCATGCTGGAGAAGTGCTGG + Exonic
951040242 3:17981605-17981627 TCCCCCAGCTCTGGGAGTGCAGG - Intronic
952049982 3:29373214-29373236 TGCCCATGATCAGTGGGTTCTGG - Intronic
954812656 3:53257546-53257568 TGCCCATACTCAGAGAGCTCTGG + Intergenic
961968951 3:130938639-130938661 TGCCCATGGTCAGGTGGAGCTGG + Intronic
964768019 3:160197341-160197363 TGTCCAAGCACAGGGAGCGCAGG - Intergenic
969073521 4:4558727-4558749 TGCCCATCCTCAAGGATGGCAGG + Intergenic
969244900 4:5925653-5925675 GGGCCGTGCTCAGGCAGTGCTGG - Intronic
969454585 4:7294196-7294218 AGCCCATGATGAGGCAGTGCCGG + Intronic
972280193 4:37594711-37594733 TGTCCATGCTCAGTAAGTGCTGG + Intronic
972885201 4:43476804-43476826 TGGGGATGCTAAGGGAGTGCTGG - Intergenic
975448730 4:74500085-74500107 AGCCCAGGCTCTGGGAGTTCAGG + Intergenic
977771907 4:100870060-100870082 TGCCCATGAACAGGAAGTTCTGG + Intronic
980007616 4:127559551-127559573 GCCCCATGCTCAGGCAGAGCTGG + Intergenic
983160123 4:164402964-164402986 AGCACTTGCTGAGGGAGTGCGGG + Intergenic
985520935 5:373690-373712 CCCCCAGGCTCAGGGAGGGCGGG + Intronic
988558790 5:32261539-32261561 AGCACATGGTTAGGGAGTGCTGG - Intronic
988658665 5:33240123-33240145 AGCCCATGCTAAGAGAGTTCGGG + Intergenic
988845362 5:35122266-35122288 GGTACATGCTCAGGGTGTGCAGG + Intronic
989758360 5:44983678-44983700 TTCTTATGTTCAGGGAGTGCTGG + Intergenic
993516411 5:88841249-88841271 TCCCAAAGTTCAGGGAGTGCAGG - Intronic
993697353 5:91077590-91077612 AGGCCATGCTCAGGGAGGGAAGG - Intronic
999057123 5:148590003-148590025 TGCCAAGGATTAGGGAGTGCTGG - Intronic
999091468 5:148940098-148940120 TGCCCATGATCAGGGCTTGTGGG - Intronic
999267409 5:150275917-150275939 TCCCCATTCTCAGGGAGGGGAGG - Intronic
1001583941 5:172820244-172820266 TGCGCTTCCTCAGGGAGGGCCGG - Intergenic
1002343960 5:178535393-178535415 TGCCCACACCCACGGAGTGCTGG - Intronic
1002473796 5:179452718-179452740 TGCCCTGGCTCAGGGCGCGCAGG + Intergenic
1002910949 6:1490646-1490668 TGCTCATGCTAAAGGATTGCTGG - Intergenic
1003228102 6:4224561-4224583 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1004036163 6:11926156-11926178 TTCCTGTCCTCAGGGAGTGCAGG - Intergenic
1004180815 6:13379109-13379131 TGCCAAGGCCCAGGGAGTGGTGG + Intronic
1004292677 6:14382748-14382770 TGCCCATGCAGAAGGAGGGCAGG - Intergenic
1006511947 6:34526230-34526252 TGCTCATGCACTGGGAGGGCAGG - Exonic
1006614006 6:35312472-35312494 TGGCCATGCTGAGGGTGTCCCGG - Exonic
1006645757 6:35512947-35512969 TCCCCCTGCTCAAGGAGTGGAGG + Intergenic
1006888447 6:37402039-37402061 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1007357576 6:41332598-41332620 GGCCTGGGCTCAGGGAGTGCAGG - Intergenic
1007388202 6:41533698-41533720 TGCCCAAGGTCAGGGAGGGTGGG - Intergenic
1012243253 6:96897864-96897886 TGCGCATGCTCCGGGTGTCCCGG - Exonic
1015883520 6:137892981-137893003 TTCCCATGCTCAGGGAGGAAAGG + Intergenic
1016980824 6:149852410-149852432 TGCCTATGCTCAGGAAGTCTTGG - Intronic
1022779076 7:33559889-33559911 TGCCCAGGATCAGGGAGATCTGG - Intronic
1023170995 7:37390321-37390343 TTCCCTTGCACAGTGAGTGCGGG - Intronic
1023359458 7:39400486-39400508 TGGCAATGCTCAGGCACTGCTGG - Intronic
1023754931 7:43407654-43407676 TGTCCATGGTGAGGGAGGGCGGG - Exonic
1024803259 7:53105949-53105971 TGCGCATGCTCAGGGAGGTAAGG + Intergenic
1024809410 7:53189945-53189967 TGCACATGTGCAGGGTGTGCAGG + Intergenic
1030603296 7:111612912-111612934 TTCCCATGCTCAGGGGATGGGGG - Intergenic
1032621591 7:133539206-133539228 TGTCCATTCCCAGGGAGGGCAGG - Intronic
1033106294 7:138528335-138528357 TCCCCATGTTGGGGGAGTGCTGG + Intronic
1033656903 7:143381056-143381078 GGCCTGTGCTCAGGGAGTGGGGG + Intergenic
1033714805 7:143989221-143989243 TTCCTATGTTGAGGGAGTGCTGG - Intergenic
1033757560 7:144407549-144407571 TGCCCGGGCTCTGGCAGTGCCGG - Intronic
1035417752 7:158704423-158704445 TGCCCATGCTCAGGGCTGGGGGG + Intronic
1035453862 7:158996736-158996758 TGCCCAAGCTCAGCGGGTCCAGG + Intergenic
1036081816 8:5565636-5565658 TGCCCATGAACAGGGTGTGGGGG + Intergenic
1036456041 8:8908877-8908899 TGCCCATGGTCACAGAGTGAGGG - Intergenic
1038466803 8:27772217-27772239 TGCCCAATCCCAGGGAGTGACGG + Intronic
1039839200 8:41281363-41281385 CCCCCATGCTGAGGGAGTGAGGG - Intronic
1041026622 8:53693259-53693281 GGCGCATGCGCAGGGAGCGCTGG - Intergenic
1042929975 8:74003676-74003698 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1045059560 8:98400100-98400122 GACCCATGCTCAGGGATTCCAGG + Intergenic
1045612522 8:103862588-103862610 ATCCCATGCTCATGGATTGCAGG - Intronic
1048737494 8:137518109-137518131 TGTACATGCTCAGGATGTGCAGG - Intergenic
1049518583 8:143076252-143076274 TGCTCAGGCACAGGGAGTGAGGG + Intergenic
1050593401 9:7182711-7182733 TGCCCATTCACATGGAGTGAGGG - Intergenic
1052384145 9:27805388-27805410 TGCCCATGATGAGGCAGTTCTGG + Intergenic
1055608678 9:77998127-77998149 TGCCCATGTGCAGGAAGGGCAGG + Intronic
1057272251 9:93657832-93657854 TCCCCTTGCTCAGGTAGGGCTGG + Intronic
1057825287 9:98368466-98368488 TCCCCTAGCTCAGGCAGTGCAGG + Intronic
1058105323 9:100963935-100963957 TGCCCAGGCTCAGGGCCAGCTGG + Intergenic
1058245027 9:102612292-102612314 AGCCCAAGCTCAGAGATTGCAGG + Intergenic
1061185266 9:129049287-129049309 GGCCCATGGTCAGGCAGTGGAGG + Intronic
1062031425 9:134363754-134363776 TCCCCATGCTCAGGGCGGCCTGG - Intronic
1062034601 9:134377332-134377354 TGCCCTTGGTCAGGCAGTGATGG - Intronic
1062117560 9:134817632-134817654 TGCAGGTGCTCAGGGTGTGCCGG - Intronic
1062249706 9:135588013-135588035 GGGCCATGCTCAGGGTGAGCAGG - Intergenic
1062254915 9:135616351-135616373 TGGCGATGCCCAGGGGGTGCTGG - Intergenic
1062276833 9:135735373-135735395 CACCCATGCTGAGGGAGGGCTGG - Intronic
1062308404 9:135922191-135922213 TGCCCCTCCTGAGGGGGTGCAGG - Intergenic
1062450467 9:136613763-136613785 TGACCCTGCTCAGGGAGTCTGGG - Intergenic
1185983535 X:4805940-4805962 TCCCTATGTTGAGGGAGTGCTGG + Intergenic
1186087219 X:6003542-6003564 TCCCTATGTTGAGGGAGTGCTGG + Intronic
1186422276 X:9435809-9435831 TCCCCGATCTCAGGGAGTGCAGG - Intergenic
1187033031 X:15507857-15507879 TGGCCATGATCAGGGGCTGCAGG + Intronic
1188248723 X:27864612-27864634 TGCCATTGCCCAGGGAGTGAAGG + Intergenic
1193292847 X:79796796-79796818 TCCCTATGTTGAGGGAGTGCTGG - Intergenic
1196145557 X:112312972-112312994 TGACCACCGTCAGGGAGTGCAGG + Intergenic
1197857602 X:130933421-130933443 TGCCCAAACTCAAGGAGTGGTGG - Intergenic
1200234812 X:154463160-154463182 TGCCCAAGGTCAGGGGATGCAGG - Intronic
1200415209 Y:2902819-2902841 TCCCTATGTTGAGGGAGTGCTGG - Intronic
1201729941 Y:17192515-17192537 TGCCTCTGCTCAGGCAGTGAGGG - Intergenic