ID: 1119438090

View in Genome Browser
Species Human (GRCh38)
Location 14:74611179-74611201
Sequence GTGGAGAGGCGCCTTGCGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 61}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119438090 Original CRISPR GTGGAGAGGCGCCTTGCGAA AGG Intronic
905336738 1:37249670-37249692 GGGGAGAGGAGCATTGGGAAGGG - Intergenic
907725063 1:57012417-57012439 GAGGTGAGGTGTCTTGCGAAGGG + Intronic
916678591 1:167084650-167084672 GTGGAGAGGCCCCTGGAGAGAGG + Intronic
1063076164 10:2718900-2718922 GTGGTGAGGTGCCTTGCGGTGGG + Intergenic
1064145938 10:12826566-12826588 GTGGAGAGGACCCATGGGAAGGG - Intronic
1065328491 10:24570582-24570604 GTGGAGGGGAGCTTTGCTAAAGG + Intergenic
1067296013 10:44975495-44975517 GTGGAGAGGGGACTGGAGAAGGG - Intronic
1069247016 10:66219231-66219253 GTGGCGAGGGGCCTTGGGAAAGG + Intronic
1069589320 10:69632005-69632027 CTGGGGAGGCGCCTGGAGAAAGG - Intronic
1070804741 10:79264441-79264463 GGGGAGAGGTGCCCTGAGAAGGG - Intronic
1074198321 10:111208557-111208579 GTGGAGAGGTGCCATGGAAAAGG - Intergenic
1075710875 10:124529990-124530012 CTGGAGAGGTGCCTTGCCACAGG + Intronic
1075905147 10:126074852-126074874 GTGGAAAGGAGCCCTGAGAAAGG - Intronic
1076088076 10:127653438-127653460 GTGGAGAGGCCCATGGGGAAAGG + Intergenic
1083843213 11:65316109-65316131 GAGGAGAGGCGTCTTGCTGAAGG + Intronic
1091161203 11:133422440-133422462 GTGGAGAGGAGTCTTGGGAGAGG + Intronic
1096668199 12:53180939-53180961 GAGGAGGGGCGCGTGGCGAAGGG + Intronic
1097202350 12:57289894-57289916 GTGGAGAGGAGCCTGGCTAAAGG - Intronic
1104311273 12:127656165-127656187 GAGGAGAGACCCCTTGCAAAGGG - Intergenic
1106546086 13:30732180-30732202 GTCGAAAGGCGCCTGGCGAGAGG - Intronic
1111396244 13:87672461-87672483 CTGGAGAGGCGCCTCGCGGTAGG - Intergenic
1118504810 14:66399673-66399695 GTGGAGGGGCCCCTTGAGTATGG - Intergenic
1119438090 14:74611179-74611201 GTGGAGAGGCGCCTTGCGAAAGG + Intronic
1120888024 14:89467134-89467156 GTGGAGAGCCACCGTGAGAAGGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1124725024 15:32148854-32148876 GTGGACAGGCCCCTGGCGGAGGG - Intronic
1126467819 15:48976548-48976570 GTGCATAGGCGCCTTCCGGACGG - Intergenic
1142762040 17:2048372-2048394 GTTGAGAGGTTCCTTGCTAAGGG - Intergenic
1142882797 17:2894633-2894655 GAGGAGAGTCGCTTTGCGAGAGG - Intronic
1145991647 17:29082600-29082622 GGGGACAGGCTCCTTGTGAATGG - Intronic
1147163054 17:38578900-38578922 GTGGAGAGGCGCCCGGGGAGAGG + Intronic
1147370622 17:39990151-39990173 GTGCTGAGGGGCCTTGCGAAGGG - Exonic
1147921148 17:43917851-43917873 GTGGGGAGGCTCCATGCGGATGG - Exonic
1148821428 17:50361955-50361977 GGGGAGAGGAGGCTTGGGAAAGG - Intronic
1150797219 17:68248031-68248053 GTGGCGTGGCGCAGTGCGAAGGG + Exonic
1158960202 18:62581949-62581971 GTGGAGAGTCACCTTGGGGAAGG + Intronic
1166124047 19:40703196-40703218 GTGAGGAGGCGCCTAGAGAAAGG - Intronic
937310718 2:120901457-120901479 GTGGAGAGGCGGCTTCCGCTGGG + Intronic
938741048 2:134232446-134232468 CTGAAGAGGGGCCTTGGGAAAGG + Intronic
939136236 2:138297961-138297983 GTGGAGATGTGTCTTGGGAATGG - Intergenic
945097829 2:206236449-206236471 GTGGAGAGGTACCTTGCACAGGG - Intergenic
945123354 2:206482818-206482840 GTGAAAAGGCGTCTTGGGAAAGG + Intronic
1171121314 20:22571420-22571442 GTGGGGAGGCGCTTAGCTAAGGG + Intergenic
1179831979 21:44002589-44002611 GAGGAGAGGCGCCAGGCTAAAGG + Intergenic
1181523307 22:23461806-23461828 GTAGAGAGGCTCCTTTCAAATGG + Intergenic
1182622112 22:31623954-31623976 ATGGAGAGGCAGCTTGCCAAGGG - Intronic
1183299664 22:37052590-37052612 GAGGTGAGGCGACTTGCCAAAGG - Intronic
1184357837 22:43994440-43994462 GTGGAGAGGCTCCTGGCGTGTGG + Intronic
954371694 3:50172368-50172390 GTGGAGAGGGGGCTTGCCAAGGG + Intronic
961413815 3:126742998-126743020 GTGGAGAGGTGCCTGGGGGAGGG + Intronic
968727372 4:2254014-2254036 GTGGCGACGCGCCTTGGGAAAGG - Intronic
970348944 4:15181560-15181582 GTGGAGAGCTGCCTTGCCCAAGG - Intergenic
985854145 5:2412003-2412025 GTGAGGAGGCGCCCTGGGAAGGG - Intergenic
985953795 5:3244739-3244761 TTGGAGTGGGGCCTTGTGAAAGG - Intergenic
986801523 5:11265465-11265487 GTGGAGAGGAGCTTTGCAGAGGG - Intronic
1001159233 5:169299740-169299762 ATGGAGAGGCGCTTGGAGAATGG - Intronic
1004873319 6:19929810-19929832 TTGGAGAGATGCCTTGCCAATGG - Intergenic
1007679441 6:43624351-43624373 GTGGAGGGGCATCTTGCTAAAGG - Intronic
1009611214 6:65943773-65943795 GTGGAGTGGAGGCTTGCCAAGGG - Intergenic
1009631166 6:66202729-66202751 GTGGAGAGGGGACTTGAGAGCGG - Intergenic
1011754723 6:90486873-90486895 GTGGGCAGGCGCCTAGGGAAAGG - Intergenic
1014681322 6:124433799-124433821 AAGGAGAGGCTCCTGGCGAATGG - Intronic
1019371466 7:664122-664144 GTGGAGAGAGGCCAGGCGAAGGG - Intronic
1034936660 7:155204464-155204486 GTGGAGAGGCGGCGTGCACATGG - Intergenic
1036502490 8:9326330-9326352 GTGGAAACGCGCCTTAGGAATGG - Intergenic
1045877480 8:106999390-106999412 GTGGAGAAACTCCTTGCAAAAGG + Intergenic
1049552690 8:143267716-143267738 TGGGAAAGGCGCCCTGCGAACGG - Intronic
1057565927 9:96166367-96166389 GTGCACAGGCACCTTGTGAATGG - Intergenic