ID: 1119438865

View in Genome Browser
Species Human (GRCh38)
Location 14:74614802-74614824
Sequence CAATTCCTAAAGACATATGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 212
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119438863_1119438865 21 Left 1119438863 14:74614758-74614780 CCAGACAGGAAGTGCACACAAGT 0: 1
1: 0
2: 0
3: 12
4: 104
Right 1119438865 14:74614802-74614824 CAATTCCTAAAGACATATGTTGG 0: 1
1: 0
2: 0
3: 19
4: 192

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119438865 Original CRISPR CAATTCCTAAAGACATATGT TGG Intergenic
900665771 1:3814581-3814603 GAATTCCTAAAGACATGTGGAGG - Exonic
900867955 1:5282196-5282218 CCATCCCTAAATTCATATGTGGG + Intergenic
901423155 1:9164292-9164314 CAATATCTAAAGACATTTTTGGG + Intergenic
903184928 1:21623413-21623435 CACTTCCTCCAGACAGATGTTGG + Intronic
904885901 1:33738150-33738172 CAATTCCTAAACTCAAATCTGGG - Intronic
905520651 1:38596985-38597007 CAATTTCTAAAGACAATTCTTGG + Intergenic
909805608 1:79871112-79871134 CAATTGCTAAAGATATAATTTGG + Intergenic
911437502 1:97880353-97880375 CAATTCATAAAGACCCAAGTAGG - Intronic
915789647 1:158654419-158654441 TAATTCCAAAAGATATGTGTAGG + Intronic
917627185 1:176858271-176858293 CAATTTCTGTGGACATATGTGGG - Intronic
918767459 1:188505392-188505414 CAATTCATAAAAAGATATGAAGG - Intergenic
918898422 1:190379679-190379701 CAATTAATAAAGAAATCTGTAGG + Intronic
920612084 1:207451084-207451106 CAAATGGTAAACACATATGTAGG - Intergenic
921014367 1:211174804-211174826 AATTTCCTAAATACATATTTAGG + Intergenic
921618561 1:217300583-217300605 TAATTCCTAAAGGTACATGTAGG + Intergenic
923893185 1:238238415-238238437 CAATTTATAAAGACAAAGGTAGG + Intergenic
1063658225 10:8012675-8012697 AACTTCCTAAAGAAATCTGTGGG - Intronic
1065720948 10:28628432-28628454 AAATCCCTAAAGACATAGGAAGG + Intergenic
1071079403 10:81792732-81792754 CAATTACTAAAGACATATCATGG - Intergenic
1073271331 10:102266732-102266754 CTATTCCCAAAGACATTGGTGGG + Intronic
1074462821 10:113653990-113654012 CAATTCCTAAAGCAATTTCTAGG + Intronic
1075374568 10:121968108-121968130 CAATACCTGGAGACATTTGTGGG + Intronic
1076249588 10:128974993-128975015 AAATTGCTAAATACCTATGTGGG + Intergenic
1080126084 11:28735552-28735574 AAGTTGCTATAGACATATGTTGG - Intergenic
1081078170 11:38702355-38702377 CAAAGGCTAAACACATATGTAGG - Intergenic
1084051776 11:66604889-66604911 CAATTCCTATAGGCTTAAGTTGG - Intronic
1086494957 11:87393402-87393424 CTATTCCTTAAGACATAATTAGG + Intergenic
1086605570 11:88692286-88692308 GAATTGCTAAAGACAGATATAGG - Intronic
1087433740 11:98086175-98086197 CAATTACTGAAGACATAAATAGG - Intergenic
1088560376 11:111109360-111109382 CAATTTTAAAATACATATGTGGG + Intergenic
1091711351 12:2742676-2742698 CAAATCCTGAAGACATCAGTGGG + Intergenic
1092704588 12:11268531-11268553 CAATTTCTAAAGGAAAATGTTGG + Intronic
1095220665 12:39609954-39609976 AAATTCCTAAACAATTATGTAGG + Intronic
1096095921 12:48935593-48935615 CTATTCCTCAAGACATTTGTGGG + Intronic
1097308054 12:58090687-58090709 CCATCCCTAAATTCATATGTTGG + Intergenic
1097343553 12:58466741-58466763 CAATTCCAAAAGACATAAATTGG + Intergenic
1100065950 12:90645281-90645303 CTACTGCTAAAAACATATGTTGG + Intergenic
1101486292 12:105164769-105164791 CTATTACTAAAGACATTTATTGG - Intronic
1102798527 12:115710763-115710785 CAATTCCAAAATAAATATTTTGG + Intergenic
1106827436 13:33539373-33539395 CAATTTCTAAAAACATCTGCTGG - Intergenic
1107060594 13:36155440-36155462 CACTTCCTCAAAACATAGGTAGG - Intergenic
1107397483 13:40032818-40032840 CAACCCCTAAATTCATATGTTGG - Intergenic
1107720259 13:43241083-43241105 CAATTACTAAAAAGATAAGTTGG - Intronic
1108332986 13:49409088-49409110 AAATTGCTAAAGACATAGGCTGG + Intronic
1109420901 13:62110323-62110345 CAATTTCAAAGGACAAATGTAGG + Intergenic
1109443667 13:62406210-62406232 CAGTTCCTGAAGGAATATGTGGG + Intergenic
1110469729 13:75845602-75845624 AAATTGCTAATGAAATATGTGGG + Intronic
1113012888 13:105791062-105791084 CAATGCCTAAATACATAGCTTGG + Intergenic
1113191613 13:107754577-107754599 CAACTCCTCAAGACAGATTTTGG - Intronic
1114406266 14:22459110-22459132 CAGTTCCGAAAAACATCTGTCGG - Intergenic
1114826186 14:26083031-26083053 AATTTCCTAATGACATATGATGG - Intergenic
1116078182 14:40140000-40140022 CACTTTCTAATGACATATTTTGG + Intergenic
1117998573 14:61501636-61501658 GAATTCCTGCAGACAAATGTTGG - Intronic
1118657732 14:67970293-67970315 CAATTCCAAATGACCTATGCTGG - Intronic
1119089827 14:71771558-71771580 AAAGTCCTAAAGACAAATGGTGG + Intergenic
1119372574 14:74159870-74159892 CACTTCATAAAGACAGCTGTAGG - Intronic
1119393088 14:74304454-74304476 CACTTCATAAAGACAGCTGTAGG - Intronic
1119438865 14:74614802-74614824 CAATTCCTAAAGACATATGTTGG + Intergenic
1120071250 14:80105951-80105973 CAACTCTAAAAGACATATTTTGG - Intergenic
1120330344 14:83084976-83084998 AAATTCCTACACACAAATGTTGG - Intergenic
1121596295 14:95165932-95165954 AAATTCCTAAATACGTATTTAGG + Intergenic
1128866257 15:71116922-71116944 CAATTCCTATAGATTTTTGTTGG + Intronic
1130077571 15:80702652-80702674 CAATTCCTAAAGCCAGATTTTGG - Intronic
1130393599 15:83481357-83481379 TGATTCCTAAAGCCATCTGTTGG - Intronic
1131885347 15:96906416-96906438 CAATTCCTACAGGTGTATGTGGG - Intergenic
1134083676 16:11341897-11341919 CAATGTCTGAAGACATATTTTGG + Intronic
1134229784 16:12419833-12419855 CTACTCCTAAAGCCATAGGTCGG + Intronic
1136054184 16:27675774-27675796 CAAATCCTAGAGACATACATGGG - Intronic
1138922495 16:61548947-61548969 CAATAGCCAAAGACATATTTTGG + Intergenic
1139083721 16:63559519-63559541 AAATTGTTAAAAACATATGTAGG + Intergenic
1139221690 16:65188934-65188956 CAATTTCTAAATCCACATGTAGG + Intergenic
1146107794 17:30057771-30057793 CAACTCCTGGAGACATTTGTTGG + Exonic
1146209532 17:30931295-30931317 CAATGCCTGAAGACATTTTTGGG + Intronic
1146389762 17:32411107-32411129 TAATTCCTAAAAATAAATGTGGG + Intergenic
1148404029 17:47396096-47396118 TATTTCCTAAATGCATATGTTGG - Intronic
1153262645 18:3239296-3239318 CAATGCATGAAGACAGATGTTGG + Intergenic
1153522465 18:5965710-5965732 CTATTCCTGAGGACCTATGTTGG + Intronic
1154030122 18:10746254-10746276 GTATTTCTAAAGACATATCTGGG + Intronic
1155297685 18:24400302-24400324 CAATTCCTACTTATATATGTAGG - Intergenic
1157367820 18:47082338-47082360 CAATGTCTAAAGACATATTTTGG - Intronic
1157877109 18:51284112-51284134 CAATTCCTATAATCATATTTAGG - Intergenic
1158924790 18:62244747-62244769 CAACTCCTAAAGAAATACGAGGG - Exonic
1164744546 19:30601487-30601509 CAGTCCCTGAAGCCATATGTGGG - Intronic
926518093 2:13874991-13875013 TAAAACCTAAAGACTTATGTGGG + Intergenic
926691322 2:15736111-15736133 CAATTCCTAACCACTTGTGTTGG - Intronic
928705905 2:33949568-33949590 CAATTGCTTAGGAAATATGTTGG + Intergenic
928832354 2:35502522-35502544 CAACTCCCAAGGACAAATGTGGG - Intergenic
933011231 2:77066667-77066689 CAAATCGTATAGAGATATGTAGG + Intronic
938237153 2:129715176-129715198 TAATTCCTATTGACATATTTGGG + Intergenic
939550918 2:143614444-143614466 CAAATACTGAAGACATAAGTAGG - Intronic
940338560 2:152555367-152555389 GAGGTCCTACAGACATATGTTGG - Intronic
940405613 2:153298417-153298439 CAGTTCCTGAAGACATTTTTAGG + Intergenic
941295944 2:163737465-163737487 CAATTCCTAAAGAACTTTGCCGG - Intergenic
942202517 2:173585742-173585764 CAATTCCTAGAGACATAAATGGG + Intergenic
944322275 2:198361037-198361059 CATTCCCTTAAGACATATTTGGG + Intronic
945382690 2:209160684-209160706 CAAGTTCTAAAGGCATATGAGGG + Intergenic
946978867 2:225184542-225184564 TAATACCTAAAGACTTATTTAGG + Intergenic
947585199 2:231351568-231351590 CATTTGCTAAAAATATATGTAGG - Intronic
947732847 2:232440590-232440612 CAATTCCTAAACCCATAGGGTGG + Intergenic
948170872 2:235901188-235901210 CTAATCATAAAGACATATATAGG - Intronic
948245690 2:236483369-236483391 CAATTTCCAAAAACAAATGTTGG + Intronic
1168926212 20:1581577-1581599 CAGTTCCTAGAGACAGAAGTAGG - Intronic
1169599543 20:7241871-7241893 CAAATCCTAAAGAAAAATGAAGG + Intergenic
1170501230 20:16976558-16976580 TAATTCCTAAACACATGTGGGGG + Intergenic
1172249431 20:33468513-33468535 CCATCCCTATATACATATGTAGG - Intergenic
1173329805 20:42065885-42065907 CAATTCCTGATGAAATATGATGG - Intergenic
1174212347 20:48889992-48890014 CAAACCCTTAAGACATGTGTGGG - Intergenic
1175255005 20:57637494-57637516 CAATTACTAAAGAGAGGTGTTGG - Intergenic
1177026527 21:15927343-15927365 CATTACCTAAATAAATATGTAGG - Intergenic
1177063338 21:16399084-16399106 AAATTTCAAAAGACATTTGTAGG + Intergenic
1177176982 21:17710481-17710503 CAATTGCAAAAGAAAAATGTTGG - Intergenic
1178166878 21:29988628-29988650 CAATTCTTAAAATCATATATAGG + Intergenic
1178905866 21:36635484-36635506 CAATGCCTGGAGACATATTTTGG + Intergenic
1179211936 21:39332211-39332233 GCATTCCTAAAGACATAAGTAGG - Intergenic
1179996508 21:44976824-44976846 CAACTCCTCAGGACACATGTGGG + Exonic
949560794 3:5200344-5200366 CATTTCCTTCAGAAATATGTAGG - Intronic
950754037 3:15157459-15157481 CAATTCCTACAGACAAATCCAGG + Intergenic
951312246 3:21141675-21141697 TAATTACTAAAGAAATATGTAGG - Intergenic
955797278 3:62650653-62650675 CATTTCCTTAAGAAAAATGTGGG + Intronic
956593229 3:70938702-70938724 AAATTCCTATGGAAATATGTAGG - Intergenic
956952452 3:74298061-74298083 TCATTCCTAAAGACATATCTTGG + Exonic
959545159 3:107587470-107587492 CAATTCCTAAAGAATTAGTTGGG + Intronic
959817966 3:110698229-110698251 CATTTTCTAAAGAAATATTTGGG - Intergenic
960312206 3:116130787-116130809 GAAATCCTAAACATATATGTGGG + Intronic
960657015 3:120015981-120016003 CCATACCTAAATACACATGTGGG - Intronic
970909084 4:21253320-21253342 CAATGCCTAAAGATAGAAGTAGG - Intronic
971733279 4:30413848-30413870 AAATTCCACAATACATATGTTGG - Intergenic
972209414 4:36819186-36819208 CAATTTCTAATCACATATATAGG + Intergenic
976413434 4:84744215-84744237 CACTTCCAAAAGAGATATGGTGG + Intronic
977533625 4:98230237-98230259 AAAAGCCTAAAGACATATATTGG + Intergenic
979675511 4:123405816-123405838 CAATTACAAAAGTCCTATGTTGG - Intergenic
979949332 4:126873349-126873371 CAATTTATAAAGACTTAAGTTGG + Intergenic
980457224 4:133060513-133060535 CATTTTCCAAAGACATATTTAGG - Intergenic
981028711 4:140102301-140102323 CAATTGCTAAATACAAATATAGG - Intronic
981803491 4:148685188-148685210 AAAGTCCTAAAGGCATATGGGGG + Intergenic
982028110 4:151272441-151272463 CTATTCCTAAAGACAAAGGTGGG - Intronic
982314139 4:154014248-154014270 GAATCCCAAAAGACATATTTTGG + Intergenic
984936886 4:184897583-184897605 CATCTCCTAAAGACAAATGTTGG + Intergenic
988305825 5:29493448-29493470 TAATTCCTAAAGCAATTTGTGGG - Intergenic
989317104 5:40094210-40094232 CAATACCTAATGACATCTTTGGG - Intergenic
992861816 5:80918972-80918994 GAATTCCTAAAGACGTAGATGGG + Intergenic
993113609 5:83690486-83690508 CAATTCTTTGAGAAATATGTTGG + Intronic
993687301 5:90954476-90954498 AAAATCCTAAAGACATATAAAGG + Intronic
994110992 5:96003875-96003897 AAATTCCAAAACACATATGAAGG + Intergenic
994743791 5:103653790-103653812 AAATTCCTAATGACATATAAGGG + Intergenic
995244000 5:109917121-109917143 CAAGTCCTAGAGACATTTCTGGG + Intergenic
997908529 5:137844791-137844813 CTCTTCCTAAAGACAAATGAAGG + Intergenic
998455440 5:142269131-142269153 CAATTCCTTAAGCCCTATGCAGG - Intergenic
1000565565 5:162842707-162842729 CAATTCCTGCAGTCATATGTTGG - Intergenic
1000852726 5:166360235-166360257 CAATTCCTATTGTCATATTTTGG - Intergenic
1005752950 6:28900381-28900403 CAGTTTTTAAAGAAATATGTAGG + Intergenic
1008860760 6:56147164-56147186 CAATTACTAGAGATTTATGTTGG - Intronic
1009947630 6:70358082-70358104 CAATTGCTTAAGACAGATCTTGG + Intergenic
1010014766 6:71091547-71091569 AAATTGCTAAAAACATATTTGGG - Intergenic
1011184078 6:84654939-84654961 CAATTGCCAAATACATAAGTGGG - Intergenic
1011922526 6:92598174-92598196 CAAGTCTTAAATACATAAGTTGG + Intergenic
1012033390 6:94101281-94101303 CAAGTCCTAAAGGCACAAGTAGG + Intergenic
1014732726 6:125052618-125052640 CAAATCCTAAAGTCAGATGGTGG - Intronic
1015259367 6:131217621-131217643 TAACTCCTAAAGACTCATGTTGG + Intronic
1015608465 6:134987071-134987093 CATTTTCTAAATACATATGCAGG + Intronic
1016606850 6:145938922-145938944 CAATTTCTGAAGACATTTCTGGG + Intronic
1017414943 6:154209862-154209884 CATTTTCTAAAGAAATATATTGG - Intronic
1017587730 6:155945708-155945730 GACTTCCTGAAGACCTATGTTGG + Intergenic
1018609396 6:165632826-165632848 CATTTCCTACTGACATCTGTGGG + Intronic
1019870727 7:3758322-3758344 AAATTCCAAAAAACAAATGTAGG - Intronic
1022692333 7:32669148-32669170 TGATTCCTAAAGACATCAGTAGG - Intergenic
1024300922 7:47886989-47887011 CAATTCTTTGAGACATATCTAGG + Intronic
1024727469 7:52214708-52214730 GAATTGCTGCAGACATATGTTGG + Intergenic
1027612681 7:80381110-80381132 CCATTTCTAAAGCCAAATGTTGG - Intronic
1031012474 7:116538135-116538157 CAATTTCTACAGACATTTGTGGG + Intronic
1031391241 7:121217502-121217524 CATTTCCTAAAGGCATCTGTTGG + Intronic
1031427817 7:121628739-121628761 AAATTTTAAAAGACATATGTAGG - Intergenic
1032516026 7:132506971-132506993 CATTTCCTAAAGACATACAAAGG + Intronic
1033023757 7:137753400-137753422 AAATTCCTAAATACATGTGGTGG - Intronic
1033682147 7:143604966-143604988 CACTTCCTAGAGACAGAAGTCGG - Intergenic
1033702743 7:143856947-143856969 CACTTCCTAGAGACAGAGGTCGG + Intronic
1034406983 7:150911138-150911160 CAACTTCCTAAGACATATGTAGG - Intergenic
1035869814 8:3125611-3125633 CAATTCCTAAAGACTTCTGAAGG + Intronic
1036041968 8:5094646-5094668 CAATACCTAGAGATAAATGTAGG - Intergenic
1036801659 8:11797009-11797031 CAGTTTCTGAAGACATCTGTAGG + Intronic
1037059980 8:14495898-14495920 CCATCCCTAAGGACATTTGTTGG + Intronic
1039143555 8:34420236-34420258 AAATAGCTAAAGACATATTTGGG + Intergenic
1040435074 8:47382309-47382331 CATTTCATAAAGAAATGTGTAGG + Intronic
1042613741 8:70626412-70626434 CAATTCCTAAAGATATAAATGGG + Intronic
1044328133 8:90884253-90884275 CAGATCCTGAAGACAGATGTAGG - Intronic
1046051318 8:109025913-109025935 AAATTCCAAAAGTCATATTTAGG + Intergenic
1046117279 8:109799398-109799420 CAATTCAGAAAGAGATGTGTAGG + Intergenic
1052177636 9:25483570-25483592 CAATTCCTAAGTACATGTTTGGG + Intergenic
1053830557 9:42075303-42075325 GGTTTCCCAAAGACATATGTTGG - Intronic
1054600004 9:67112152-67112174 GGTTTCCCAAAGACATATGTTGG + Intergenic
1055291123 9:74783237-74783259 CAATTCCTGAAGACAATTCTGGG - Intronic
1055843920 9:80537869-80537891 CATTTCGTAAAGACAAATGATGG + Intergenic
1057114059 9:92503779-92503801 CACCTCCTAAATACATATGCAGG - Intronic
1058654735 9:107209817-107209839 CAATTTTTAAAGACACATGGTGG + Intergenic
1059527725 9:115007777-115007799 CAAGACCTAGATACATATGTGGG - Intergenic
1059632618 9:116140879-116140901 CAATTCCTAATGAAATTTCTAGG + Intergenic
1060236425 9:121866746-121866768 TAATTACTACAGACATTTGTTGG + Intronic
1060877090 9:127091364-127091386 CAATGCAGAAAGACATGTGTTGG - Intronic
1186014646 X:5177516-5177538 GAATTCCTAAAAACATATCCTGG + Intergenic
1186248404 X:7639449-7639471 TAATTACTAAAGACATAAGTGGG - Intergenic
1186251904 X:7677360-7677382 CAATTCCTTTAAACATACGTAGG + Intergenic
1186440423 X:9581138-9581160 CAATTCCTAGGGACACATGATGG - Intronic
1187095595 X:16144472-16144494 CAATTCCTACAGACTTCCGTAGG + Intronic
1189090287 X:38075064-38075086 CAACTCCTAGAGGCATTTGTGGG - Intronic
1194273497 X:91850776-91850798 CAATTGGTAAGGACATATATAGG - Intronic
1195551528 X:106176725-106176747 AAATCCTTAAAGAGATATGTAGG - Intronic
1197737646 X:129863585-129863607 CAATGTCTAAAGACATTTTTGGG + Intergenic
1197817855 X:130517026-130517048 CAATTCCTGAACACAGAGGTTGG + Intergenic
1198840385 X:140850683-140850705 CAGTTGCTAAAGACACAGGTAGG - Intergenic
1200165534 X:154032724-154032746 AAATTCCTAAAGAAATATTTGGG - Intronic
1200590742 Y:5072196-5072218 CAATTGGTAAGGACATATATAGG - Intronic
1201637255 Y:16137352-16137374 TATTTCCTAAAGATACATGTAGG - Intergenic