ID: 1119438926

View in Genome Browser
Species Human (GRCh38)
Location 14:74615386-74615408
Sequence CACAGTAATCCCATCAAGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119438922_1119438926 19 Left 1119438922 14:74615344-74615366 CCAAGAAGTATGTGTGAAATGGA No data
Right 1119438926 14:74615386-74615408 CACAGTAATCCCATCAAGTGGGG No data
1119438920_1119438926 29 Left 1119438920 14:74615334-74615356 CCTAGAACAGCCAAGAAGTATGT No data
Right 1119438926 14:74615386-74615408 CACAGTAATCCCATCAAGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119438926 Original CRISPR CACAGTAATCCCATCAAGTG GGG Intergenic
No off target data available for this crispr