ID: 1119439458

View in Genome Browser
Species Human (GRCh38)
Location 14:74618499-74618521
Sequence ACTCAGAGCGGACCCCTAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119439458_1119439463 16 Left 1119439458 14:74618499-74618521 CCAGCTAGGGGTCCGCTCTGAGT No data
Right 1119439463 14:74618538-74618560 ATTCGCACCCACAGAGAAGAAGG No data
1119439458_1119439464 20 Left 1119439458 14:74618499-74618521 CCAGCTAGGGGTCCGCTCTGAGT No data
Right 1119439464 14:74618542-74618564 GCACCCACAGAGAAGAAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119439458 Original CRISPR ACTCAGAGCGGACCCCTAGC TGG (reversed) Intergenic
No off target data available for this crispr