ID: 1119440414

View in Genome Browser
Species Human (GRCh38)
Location 14:74624485-74624507
Sequence CTGTCTGAGCTGGGGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119440404_1119440414 23 Left 1119440404 14:74624439-74624461 CCAGCCTGGGAGCATAGGATGGT No data
Right 1119440414 14:74624485-74624507 CTGTCTGAGCTGGGGCTGGAAGG No data
1119440405_1119440414 19 Left 1119440405 14:74624443-74624465 CCTGGGAGCATAGGATGGTCAGG No data
Right 1119440414 14:74624485-74624507 CTGTCTGAGCTGGGGCTGGAAGG No data
1119440401_1119440414 29 Left 1119440401 14:74624433-74624455 CCTAATCCAGCCTGGGAGCATAG No data
Right 1119440414 14:74624485-74624507 CTGTCTGAGCTGGGGCTGGAAGG No data
1119440409_1119440414 -10 Left 1119440409 14:74624472-74624494 CCTAGAGAAGATGCTGTCTGAGC No data
Right 1119440414 14:74624485-74624507 CTGTCTGAGCTGGGGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119440414 Original CRISPR CTGTCTGAGCTGGGGCTGGA AGG Intergenic
No off target data available for this crispr