ID: 1119442137

View in Genome Browser
Species Human (GRCh38)
Location 14:74635571-74635593
Sequence ATGTGGATGCAGAATTGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119442130_1119442137 23 Left 1119442130 14:74635525-74635547 CCAGAAATATTTTGGTGGTGAAG No data
Right 1119442137 14:74635571-74635593 ATGTGGATGCAGAATTGGAAGGG No data
1119442134_1119442137 -10 Left 1119442134 14:74635558-74635580 CCAAGTTTTAAGGATGTGGATGC No data
Right 1119442137 14:74635571-74635593 ATGTGGATGCAGAATTGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119442137 Original CRISPR ATGTGGATGCAGAATTGGAA GGG Intergenic
No off target data available for this crispr