ID: 1119444336

View in Genome Browser
Species Human (GRCh38)
Location 14:74650771-74650793
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119444336_1119444339 -2 Left 1119444336 14:74650771-74650793 CCCAATGTGACAGCTGCTGATCC No data
Right 1119444339 14:74650792-74650814 CCTGCACCTGCCACTGTGTCAGG No data
1119444336_1119444343 21 Left 1119444336 14:74650771-74650793 CCCAATGTGACAGCTGCTGATCC No data
Right 1119444343 14:74650815-74650837 TGAATCAGCACAGTGTATGGTGG No data
1119444336_1119444342 18 Left 1119444336 14:74650771-74650793 CCCAATGTGACAGCTGCTGATCC No data
Right 1119444342 14:74650812-74650834 AGGTGAATCAGCACAGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119444336 Original CRISPR GGATCAGCAGCTGTCACATT GGG (reversed) Intergenic