ID: 1119444336 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 14:74650771-74650793 |
Sequence | GGATCAGCAGCTGTCACATT GGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1119444336_1119444339 | -2 | Left | 1119444336 | 14:74650771-74650793 | CCCAATGTGACAGCTGCTGATCC | No data | ||
Right | 1119444339 | 14:74650792-74650814 | CCTGCACCTGCCACTGTGTCAGG | No data | ||||
1119444336_1119444343 | 21 | Left | 1119444336 | 14:74650771-74650793 | CCCAATGTGACAGCTGCTGATCC | No data | ||
Right | 1119444343 | 14:74650815-74650837 | TGAATCAGCACAGTGTATGGTGG | No data | ||||
1119444336_1119444342 | 18 | Left | 1119444336 | 14:74650771-74650793 | CCCAATGTGACAGCTGCTGATCC | No data | ||
Right | 1119444342 | 14:74650812-74650834 | AGGTGAATCAGCACAGTGTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1119444336 | Original CRISPR | GGATCAGCAGCTGTCACATT GGG (reversed) | Intergenic | ||