ID: 1119444337 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 14:74650772-74650794 |
| Sequence | AGGATCAGCAGCTGTCACAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1119444337_1119444343 | 20 | Left | 1119444337 | 14:74650772-74650794 | CCAATGTGACAGCTGCTGATCCT | No data | ||
| Right | 1119444343 | 14:74650815-74650837 | TGAATCAGCACAGTGTATGGTGG | No data | ||||
| 1119444337_1119444342 | 17 | Left | 1119444337 | 14:74650772-74650794 | CCAATGTGACAGCTGCTGATCCT | No data | ||
| Right | 1119444342 | 14:74650812-74650834 | AGGTGAATCAGCACAGTGTATGG | No data | ||||
| 1119444337_1119444339 | -3 | Left | 1119444337 | 14:74650772-74650794 | CCAATGTGACAGCTGCTGATCCT | No data | ||
| Right | 1119444339 | 14:74650792-74650814 | CCTGCACCTGCCACTGTGTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1119444337 | Original CRISPR | AGGATCAGCAGCTGTCACAT TGG (reversed) | Intergenic | ||