ID: 1119444337

View in Genome Browser
Species Human (GRCh38)
Location 14:74650772-74650794
Sequence AGGATCAGCAGCTGTCACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119444337_1119444343 20 Left 1119444337 14:74650772-74650794 CCAATGTGACAGCTGCTGATCCT No data
Right 1119444343 14:74650815-74650837 TGAATCAGCACAGTGTATGGTGG No data
1119444337_1119444342 17 Left 1119444337 14:74650772-74650794 CCAATGTGACAGCTGCTGATCCT No data
Right 1119444342 14:74650812-74650834 AGGTGAATCAGCACAGTGTATGG No data
1119444337_1119444339 -3 Left 1119444337 14:74650772-74650794 CCAATGTGACAGCTGCTGATCCT No data
Right 1119444339 14:74650792-74650814 CCTGCACCTGCCACTGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119444337 Original CRISPR AGGATCAGCAGCTGTCACAT TGG (reversed) Intergenic