ID: 1119444339

View in Genome Browser
Species Human (GRCh38)
Location 14:74650792-74650814
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119444337_1119444339 -3 Left 1119444337 14:74650772-74650794 CCAATGTGACAGCTGCTGATCCT No data
Right 1119444339 14:74650792-74650814 CCTGCACCTGCCACTGTGTCAGG No data
1119444335_1119444339 18 Left 1119444335 14:74650751-74650773 CCTGTCTTCATACTTCTGGTCCC No data
Right 1119444339 14:74650792-74650814 CCTGCACCTGCCACTGTGTCAGG No data
1119444336_1119444339 -2 Left 1119444336 14:74650771-74650793 CCCAATGTGACAGCTGCTGATCC No data
Right 1119444339 14:74650792-74650814 CCTGCACCTGCCACTGTGTCAGG No data
1119444333_1119444339 23 Left 1119444333 14:74650746-74650768 CCTCTCCTGTCTTCATACTTCTG No data
Right 1119444339 14:74650792-74650814 CCTGCACCTGCCACTGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119444339 Original CRISPR CCTGCACCTGCCACTGTGTC AGG Intergenic