ID: 1119444341

View in Genome Browser
Species Human (GRCh38)
Location 14:74650802-74650824
Sequence TGCTGATTCACCTGACACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119444341_1119444344 20 Left 1119444341 14:74650802-74650824 CCACTGTGTCAGGTGAATCAGCA No data
Right 1119444344 14:74650845-74650867 TCTACAAGCCATTTATAATCAGG No data
1119444341_1119444343 -10 Left 1119444341 14:74650802-74650824 CCACTGTGTCAGGTGAATCAGCA No data
Right 1119444343 14:74650815-74650837 TGAATCAGCACAGTGTATGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119444341 Original CRISPR TGCTGATTCACCTGACACAG TGG (reversed) Intergenic