ID: 1119444342

View in Genome Browser
Species Human (GRCh38)
Location 14:74650812-74650834
Sequence AGGTGAATCAGCACAGTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1119444337_1119444342 17 Left 1119444337 14:74650772-74650794 CCAATGTGACAGCTGCTGATCCT No data
Right 1119444342 14:74650812-74650834 AGGTGAATCAGCACAGTGTATGG No data
1119444338_1119444342 -3 Left 1119444338 14:74650792-74650814 CCTGCACCTGCCACTGTGTCAGG No data
Right 1119444342 14:74650812-74650834 AGGTGAATCAGCACAGTGTATGG No data
1119444336_1119444342 18 Left 1119444336 14:74650771-74650793 CCCAATGTGACAGCTGCTGATCC No data
Right 1119444342 14:74650812-74650834 AGGTGAATCAGCACAGTGTATGG No data
1119444340_1119444342 -9 Left 1119444340 14:74650798-74650820 CCTGCCACTGTGTCAGGTGAATC No data
Right 1119444342 14:74650812-74650834 AGGTGAATCAGCACAGTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1119444342 Original CRISPR AGGTGAATCAGCACAGTGTA TGG Intergenic